Exam 2 - Fall 2023

pdf

School

Indiana University, Bloomington *

*We aren’t endorsed by this school

Course

319

Subject

Biology

Date

Apr 3, 2024

Type

pdf

Pages

Uploaded by nmcleish

1 L319: Genetics Lab Name:______________________________ Exam 2A: Drosophila , CRISPR, Sushi, and C. elegans Lab Section:_________________________ Fall 2023 1. Assume the following as a hypothetical case: You perform a Po: cross between true breeding male, wild type flies and virgin female flies that are homozygous for three recessive, X chromosome-linked mutant genes; one mutant gene confers a brown eye phenotype (bn), a second confers a stubble- bristle phenotype (sb), and the third confers a dumpy body phenotype (dpy). You then cross F1 males to F1 females and examine the F2 progeny for the X-linked traits. Based on the data below answer the following: Show your work! a. Calculate the map distance between each of the gene pairs using the data listed below. Show all calculations. (9 points) b. Based on the calculations in part a. above, provide a genetic map that describes the distances between these genes and the order of these genes on the X chromosome. How confident are you in the map? (3 points) Gene Pairs on X chromosome Body Size + dpy Eye Color + 370 70 bn 62 348 c. If both the F1 male and female flies in the cross above were also heterozygous for the autosomal dominant trait “Tall body” (Tal) and if the dumpy body trait (dpy) is epistatic to Tal, how many flies in the cross above should have had Tall body? Dumpy body? (5 points) Bristle Shape + sb Eye Color + 305 123 bn 131 291 Bristle Shape + sb Body Size + 237 183 dpy 166 264

2 2. If the actual body size data collected for the cross above (Question 1c) gives you the distribution below when you score 850 flies, what do you conclude about the relationship between dumpy body (dpy) and Tall body (Tal) in terms of epistasis? Use Χ 2 analysis to test whether or not Tal shows up as much as you would expect if there is epistasis in the cross and dpy is epistatic to Tal . State the null hypothesis , the degrees of freedom and the p value . Clearly state whether or not you reject the null hypothesis and what you can conclude about the relationship between dpy and Tal in this cross. (10 points). Show your work! +* = wild type or Tall body + = wild type body 3. Given the recombination map you calculated and the epistatic relationship between dpy and Tal given in Question 1 above, how many flies would you expect to have the following phenotype: brown body color, wild type body size, and wild type bristles if you scored 850 flies? (3 points) Body Size +* 429 dpy 421 Body Size + 91 Tal 338

3 4. Assuming that the gene causing the long bristle phenotype ( lng ) maps 31 cM to the right of the gene for smooth eyes ( smo ) on chromosome II in Drosophila and lng maps 22 cM to the left of a gene for the no antennae phenotype ( noa ) on chromosome II, answer the following: a. What is the ideal cross to test this genetic arrangement? Assume that all of the mutant traits, described to you above, are recessive. Note: I am only asking you for the cross, NOT a Punnett square! Explain what makes this an ideal cross. (4 points) b. If you score 850 flies from an ideal test cross, what results do you expect? Fill in the following: (6 points) Bristle Size + lng Ant. Size + noa Eye Shape + smo Ant. Size + noa c. How many flies out of the above experiment would you expect to have the genotype lng; smo; +? (3 points) Gene Pairs on chromosome II Bristle Size + lng Eye Shape + smo

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

4 5. For Experiment 2 you did reverse genetics in yeast. a. What was the specific objective of Experiment 2? (2 points) b. List 2 specific conclusions we can draw from our data about the most efficient way to accomplish our objective in Experiment 2. (4 points) 6. At right is an agarose gel through which a 100 bp ladder has been run (L) and through which colony PCR reactions from Experiment 2 have also been run (Lanes 1-4). Each reaction shown was from Transformation 1A . Answer the following: a. Explain what happened to create the result in Lane 1 and whether this was what we expected. (2 points) b. Explain what happened to create the result in Lane 3 and whether this was what we expected. (2 points) c. If we sequenced the PCR product from Lane 4 above and compared it to the wild type His1 sequence, what differences would we most likely find given our data ? (2 points). Be specific! d. In the first step of Experiment 2, we got very few transformants from the 1A transformation. Given what we know now at the end of the experiment, why did we get so few transformants? (3 points) 7. For Experiment 4 , explain why you might get a high score (above 99% identity) while searching the NCBI database with BLAST and get no result while searching the BOLD database with the same CO1 sequence. What should you do to attempt to rectify the situation? (2 points)

5 8. Use the table at right to answer the following: a. What is the proper consensus sequence for the alignment below? (4 points) Species 1: 5’- TCTGTACATTCACGCCGAGT - 3’ Species 2: 5’– TCCATACTATAACGCGTATT - 3’ Species 3: 5’- TCTCTACGCTAGCGCCCATA - 3’ Consensus: b. Design 10 bp degenerate primers that will be most effective at amplifying the consensus sequence below. (8 points) 5’- ASBTCGCTACCWTSAVYACT ............... CAGRYTCGGATKCCTYSTAH -3’ (“ ........ ” indicates ~300 bases of additional DNA sequence) Forward Primer: Reverse Primer: 9. At right you can see an agarose gel through which a 100 bp marker has been run (L) and through which 4 PCR reactions from various fish samples have been run (Lanes 1-4). a. Explain the results for each lane (be specific). Assume these are PCR reactions from Experiment 4 in which we were attempting to amplify the DNA barcoding gene. (4 points) b. What distinguishes the kind of PCR reaction we do for Sanger sequencing from the kind of PCR reaction we do when trying to generate a DNA template to sequence (i.e., the CO1 gene from fish)? Mention at least two (2) differences between these two types of PCR reaction. (2 points)

6 c. From our fish data in Experiment 4 , list two conclusions you can draw about the differences between fish sold in grocery stores and restaurants in Bloomington, IN? (4 points) 10. Use a diagram to explain how dsRNA is produced using the E. coli strain, HT115 (DE3) and the plasmid named pL4440. Be specific about the features of the bacteria and the plasmid, which allow us to knock down a gene of interest in C. elegans . (6 points) 11. Explain the difference between mechanisms producing the mutant phenotypes we looked at during the second week of Experiment 5A and those we looked at during the third week when we scored our RNAi plates. What was the source of the mutant phenotypes in the two different weeks? (4 points) 12. For the following genes tested in Experiment 5A , compare the results we got from RNAi compared to the mutant phenotypes we observed the week before. Be sure to mention both penetrance and expressivity of each gene. (6 points) Dpy-10: Bli-1:

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

7 13. Which of the following cellular process(es) is(are) impacted by RNAi inside worm cells? Circle all that apply . (2 points) A. DNA replication B. RNA replication C. Transcription D. Translation E. Proteolysis F. Methylation G. Splicing H. Nuclear export Extra credit: 14. From the class data in Experiment 3B we determined that the wit trait is epistatic to hsy. Despite that fact, hsy showed up (in the data in which wit was present) about 15% of the time. What did we expect for hsy and what might explain the discrepancy? (3 points) 15. Based on our experiments this semester, list one advantage and one disadvantage of the two methods of doing reverse genetics that we have tried. (2 points)

Related Documents

BIO181.docx

Evan Zhao DIS 7 Wks.pdf

Jade W7 Essay.docx

Quiz 11_ Attempt review _ Courses 2023-2024.pdf

Lab 1B Report Guidelines.docx

iNaturalist Orientation and Enrollment Worksheet S24 Update.docx

Exam 1 - Fall 2023.pdf

Lecture Exam 4 Practice_S22.docx

Thomas_Sierra_Biol 150 Lab Exam 1 Review FALL2020(1)(2).docx

Choi, James_Report_Digestion Analysis.pdf

Biol2000 Problem set Chp 2-3.docx

BIOL2000 Problem set Chapter 8.docx

Recommended textbooks for you

Biology 2e

Biology

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:OpenStax

Comprehensive Medical Terminology

Nursing

ISBN:9781133478850

Author:Jones

Publisher:Cengage

Human Heredity: Principles and Issues (MindTap Co...

Biology

ISBN:9781305251052

Author:Michael Cummings

Publisher:Cengage Learning

Intro To Health Care

Health & Nutrition

ISBN:9781337338295

Author:Mitchell

Publisher:Cengage

Principles Of Pharmacology Med Assist

Biology

ISBN:9781337512442

Author:RICE

Publisher:Cengage

3-2-1 Code It

Biology

ISBN:9781337660549

Author:GREEN

Publisher:Cengage

SEE MORE TEXTBOOKS

Recommended textbooks for you

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Comprehensive Medical Terminology
Nursing
ISBN:9781133478850
Author:Jones
Publisher:Cengage
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Intro To Health Care
Health & Nutrition
ISBN:9781337338295
Author:Mitchell
Publisher:Cengage
Principles Of Pharmacology Med Assist
Biology
ISBN:9781337512442
Author:RICE
Publisher:Cengage
3-2-1 Code It
Biology
ISBN:9781337660549
Author:GREEN
Publisher:Cengage