MCB1 Practice Exam 1: Key Concepts and Questions Explained

MCB1 (BIOL-UA 21) Practice Exam 1 NAME NetID ( e.g. , ms4131) Write concisely and legibly in the spaces provided!!! You do not need any more room for your answers than what is provided. Write your name and NetID on each page. PART I (short answer, limited partial credit, 5 pts each): 1) Recall that the wobble position follows non-standard base-pairing rules. These rules can be summarized as: 1) standard base pairs are allowed; 2) G-U base pairs are allowed; and 3) inosine can base pair with A, C, or U. Based on these rules, complete the five columns in this table from your textbook : 2) The image at right shows part of SARS-CoV-2 protein nsp13. a) In the box below, describe concisely yet specifically the secondary- and tertiary-structure features of the part of nsp13 that is shown. b) The nsp13 protein is a helicase that acts on the SARS-CoV-2 genome (and not on the host genome). In the box below, state one specific biological process for which the virus might require this helicase. Recall that SARS-CoV-2 is a positive-sense RNA virus (its genome is an mRNA).

MCB1 (BIOL-UA 21) Practice Exam 1 NAME NetID ( e.g. , ms4131) 3) Below is a DNA sequence, part of which will be amplified by PCR. 5ʹ–GTTATCGACTTTACGGAACGTTCGGGAAATAAACCCC The forward primer sequence is 5ʹ–GACTTT. (Note for simplicity, the primer is only 6 nucleotides long, as opposed to the usual 20 or so nucleotides. Assume PCR still works fine.) a) If you wish your PCR product to be 18 base pairs long, what is the sequence of the 6- nucleotide reverse primer that you should use? Enter your answer in the box below, starting with the 5ʹ nucleotide : b) In the box below, write the sequence of the 3ʹ-most five bases in the vast majority of strands produced by extension of the reverse primer during the PCR reaction ( only put the five letters, from 5ʹ to 3ʹ , e.g.: AAAAA). 4) The image at right depicts an electron micrograph of an mRNA molecule hybridized to one strand of DNA from the corresponding gene. a) Which strand of the gene was used for this experiment ( circle one ): template strand nontemplate strand b) How many exons does the gene have ( circle one )? 1 2 3 4 c) Does the arrow in the image point to a 5ʹ or 3ʹ end ( circle one )? 5ʹ end 3ʹ end

MCB1 (BIOL-UA 21) Practice Exam 1 NAME NetID ( e.g. , ms4131) 5) There are more than 20 amino acids, but organisms only use 20 in their proteins; the rest are considered “unnatural.” Biologists have artificially expanded the genetic code so that an organism can incorporate 21 amino acids in its proteins. They did it by “reprogramming” one of the three stop codons to encode the additional, unnatural amino acid. a) This reprogramming at a minimum requires the organism’s genome to be engineered to express two new components: a functional RNA molecule and an enzyme. In the appropriate boxes below, state the name of the type of functional RNA molecule and the name of the type of enzyme : RNA: enzyme: b) The Sc2.0 project, led by Jef Boeke at NYU’s Institute for Systems Genetics, aims to re-engineer and synthesize the Saccharomyces cerevisiae (yeast) genome. One part of this work is to convert all UAG stop codons in the genome to UAA stop codons, and then to use UAG to encode an unnatural amino acid. What would the consequence be of not converting the UAG stop codons to UAA stop codons (circle one)? UAG codons would get confused for AUG codons and thus disrupt translation initiation. The unnatural amino acid would get incorporated into many proteins and extra codons after the UAG stop codon would also be translated during synthesis of these proteins. Translation would never terminate and so reinitiation of translation would not happen. 6) Tenofovir (TFV) prevents the human immunodeficiency virus (HIV) from making copies of itself. The structure of TFV is shown at right: a) Based on the structure of TFV, how does it stop HIV from making copies of itself? Enter your answer as one concise yet specific sentence in the box below : b) For TFV to work, human cells must modify it first. What modification of TFV must happen for it to stop HIV from making copies of itself? Enter your answer as one concise yet specific sentence in the box below :

Your preview ends here

Eager to read complete document? Join bartleby learn and gain access to the full version

Access to all documents
Unlimited textbook solutions
24/7 expert homework help

MCB1 (BIOL-UA 21) Practice Exam 1 NAME NetID ( e.g. , ms4131) PART II (long answer, partial credit given so show your work, 1 2 pts each): 7) SARS-CoV-2 emerged in late 2019 and causes COVID-19. SARS-CoV emerged in 2003 and causes SARS. Both viruses target the ACE2 protein for entry into human cells. The dissociation constant, K d , of the SARS-CoV-2 spike protein S1 and ACE2 is approximately 10 –8 M. The K d of the SARS-CoV virus S1 protein and ACE2 is approximately 4 X 10 –8 M. a) Which virus’s S1 protein has higher affinity for ACE2 ( circle one )? SARS-CoV SARS-CoV-2 b) You develop a diagnostic test for SARS-CoV-2 based on the affinity of S1 for ACE2. Your test uses tiny volumes of concentrated saliva. If there are 10 molecules of S1 in a volume of 1.667 X 10 –15 L, what is the concentration of S1 in units of molarity? (The number of molecules per mole, Avogadro’s number, is 6 X 10 23 .) In the box below, show your calculation and state your final answer clearly . c) Still assuming there are 10 molecules of S1 in a volume of 1.667 X 10 –15 L, what is the minimum number of molecules of ACE2 that you need to add so that at least half of the molecules of S1 are bound to ACE2 at equilibrium? In the box below, show your calculation and state your final answer clearly .

MCB1 (BIOL-UA 21) Practice Exam 1 NAME NetID ( e.g. , ms4131) 8) The schematic diagram of translation initiation below is very similar to one from your textbook: a) What are the names of the proteins labeled X and Y ? Enter your answers in the corresponding boxes below : X : Y : b) In one or two concise yet specific sentences in the box below, describe the effect on the efficiency of translation of X binding to Y , which binds to Z : c) What site of the ribosome does the protein labeled 1A occupy ( circle one )? E P A d) When is the GTP that is bound to the protein labeled 2 hydrolyzed? Enter your answer as one concise yet specific sentence in the box below :

MCB1 Practice Exam

Related Documents