Summary of Protein Synthesis

Section Objectives  Students will be able to summarize protein synthesis. Protein Synthesis An organism’s genetic code contains all the information needed to make both individuals cells and the entire organism. Almost every part of a cell, including proteins, enzymes, ribosomes, and organelles are made from proteins. The process of making a protein is called protein synthesis . To synthesize something means to make it from several different parts. A protein is synthesized from many different amino acids (Figure 1). From DNA to Protein As discovered by Beadle and Tatum, the code for each protein is contained within a separate gene. The DNA bases in a gene are organized into codons. These codons are read by the enzyme RNA polymerase to make a RNA transcript. Figure 1: Biologists can now synthesize custom proteins in their laboratory. The mRNA is shipped out of the nucleus to the cytoplasm. There it translated into amino acids. A ribosome reads the mRNA and adds new amino acids from transfer RNAs. The growing chain of amino acids is called a polypeptide. This process is called elongation . Translation continues along the entire length of the mRNA. It will continue along the entire length of the mRNA until the ribosome reaches the stop codon. Stop codons can be UAA, UAG, UGA. There are no tRNAs with anticodons that match this codon. Instead, a release factor binds to these types of codons. The polypeptide can therefore not grow anymore and is dropped from the ribosome. The ribosome then releases from the mRNA. A single polypeptide chain can be made from hundreds or even thousands, of amino acids. Beadle and Tatum won half of the Nobel Prize in Physiology or Medicine in 1958 for their work supporting the one gene-one polypeptide theory. The other half of the prize went to Joshua Lederberg for his work showing that bacteria can "mate" and exchange genetic information.

It is important to remember the role of the complimentary bases in DNA translation and mRNA translation. When mRNA is made, it is complimentary to the DNA template. The tRNA molecules that bring amino acids to the ribosome have an anticodon that is complimentary to the mRNA strand. Therefore, if a DNA strand has the sequence: TACTTATTACTACTT It can be divided into five different codons, like this: TAC TTA TTA CTA CTT Because uracil (U) is used instead of thymine T, the DNA would be transcribed by RNA syntheses into this mRNA: AUG AAU AAU GAU GAA The mRNA would then be translated by the ribosomes into a polypeptide. The anticodons of the tRNAs would have the following anticodons: UAC UUA UUA CUA CUU The sequence of anticodons is very similar to the original DNA template. The only difference, in fact, it that U is used instead of T. The codons AUG AAU AAU GAU GAA will be translated into a polypeptide chain containing these amino acids: Methionine – Asparagine – Asparagine – Aspartic Acid – Glutamine The long names of the amino acids are often abbreviated like this: Met-Asn-Asn-Asp-Glu Amino Acids and Codons There are 20 different amino acids used to synthesize protein, and 64 codons. All but two amino acids are represented by more than one codon. Table 1 shows all the different codons for each amino acid. It also shows the codons for the start codon and the stop codon.

2nd base U C A G 1st base U UUU Phenylalanine UUC UUA Leucine UUG UCU Serine UCC UCA UCG UAU Tyrosine UAC UAA STOP UAG STOP UGU Cysteine UGC UGA STOP UGG Tryptophan C CUU Leucine CUC CUA CUG CCU Proline CCC CCA CCG CAU Histidine CAC CAA Glutamine CAG CGU Arginine CGC CGA CGG A AUU Isoleucine AUC Ile/IIsoleucine AUA AUG Methionine , START ACU Threonine ACC ACA ACG AAU Asparagine AAC AAA Lysine AAG AGU Serine AGC AGA Arginine AGG G GUU Valine GUC GUA GUG GCU Alanine GCC GCA GCG GAU Aspartic acid GAC GAA Glutamic acid GAG GGU Glycine GGC GGA GGG Table 2: The 64 codons can be arranged in a table, so the amino acid they represent can easily be found. The first base in the codon is listed on the left side. The second base in the codon is listed on the top. Summary DNA contains the genetic information for making proteins. The process of making proteins is called protein synthesis. DNA is first transcripted into mRNA, and the mRNA to a polypeptide chain. Each codon represents an amino acid. Comparing the sequence of bases in an mRNA molecule to a codon table allows you to translate the mRNA into a polypeptide. Polypeptides are then folded into proteins, and proteins are used to build the various parts of a cell. Concept Reinforcement 1. mRNA is complementary to the template strand of DNA. What other molecule is complementary to the template strand? 2. What is the first amino of every polypeptide? Notice that the start codon and the codon for methionine Met both are AUG. 3. Using table Table 1 and 2 translate the following DNA sequence into a polypeptide. AUGCCUCCUCGUGUUACGUAG