diverse wrriting essay

pdf

School

University of California, Berkeley *

*We aren’t endorsed by this school

Course

123

Subject

Anthropology

Date

Oct 30, 2023

Type

pdf

Pages

1

Uploaded by BrigadierSeahorse7611

Report
The Chilkat tunic represents Native American fashion as the clothing contains recognizable patterns, and its silhouette is typical for the indigenous culture. Furthermore, specific ornaments, colors, and clothing lengths distinct populations belonging to different areas. The artist represents the Tahltan Pacific Northwest tribes, and it explains the selection of black and white palettes (Portland Art Museum). The tunic also has a leather belt, demonstrating how modern fashion inherited the pieces of clothing that previously served as weapon carriers or spiritual protectors. Native American fashion collections aim to show respect and immortality of the indigenous culture; however, implementing the items in modern life is false memorization. Indeed, people’s wardrobes evolved as needs for specific clothing emerged, and today, cultural and spiritual context is not equal to the times of Native American tribes’ thriving. The ‘Native Fashion Now’ project is dedicated to the celebration of indigenous designers and helping the nation recall its roots in the continuously evolving culture (Portland Art Museum). American clothes, such as tunics and ethnic ornaments, should be memorized in diverse ways yet integrated into daily life because it diminishes their value and may be incorrectly perceived by the tribes’ heirs.
Discover more documents: Sign up today!
Unlock a world of knowledge! Explore tailored content for a richer learning experience. Here's what you'll get:
  • Access to all documents
  • Unlimited textbook solutions
  • 24/7 expert homework help

Related Documents

Ferguson+pp+1-21(1).pdf
additonal classics notes.docx
Anthro Health Sem.pdf
_“Stone Agers in the Fast Lane_ Chronic Degenerative Diseases in Evolutionary Perspective,”.pdf
devoted wrriting essay .pdf
visual wrriting essay .pdf
Arch E11 (1).pdf
Arch E10_Annotated Bibliography.pdf
Week Four Assignment.docx
E.4_finds_sheet (3).pdf
Arch E6 (1).pdf
culture essay .pdf
Recommended textbooks for you
Text book image
Essentials of Physical Anthropology (Third Editio...
Anthropology
ISBN:9780393938661
Author:Clark Spencer Larsen
Publisher:W. W. Norton & Company
SEE MORE TEXTBOOKS
Recommended textbooks for you
Text book image
Essentials of Physical Anthropology (Third Editio...
Anthropology
ISBN:9780393938661
Author:Clark Spencer Larsen
Publisher:W. W. Norton & Company
SEE MORE TEXTBOOKS

Browse Popular Homework Q&A

Q: he decline of salmon fisheries along the Columbia River in Oregon has caused great concern among…
Q: Find the arc length of the curve on the given interval. (Round your answer to three decimal places.)…
Q: The core value of "Courage" mean... O building a sense of community, developing a strong religious…
Q: Explain why a person's attitude will help the recovery process.
Q: about the relationship between humidity and rate of evaporation, wh
Q: Q10. The platform is rotating about the vertical axis such that at any instant its angular position…
Q: How do atoms of neon-20 and neon-22 differ?
Q: Test the claim at the 5% significance level that a suitable model for these data is a Poisson…
Q: se the digits 0-9 (only once each) to fill in the x²-x- 19x² - 1 (A+x)(x² + SI E x²- 4 |> X X
Q: Two blocks with masses M1 and M2 hang one under the other. For this problem, take the positive…
Q: Q6. As shown in the image below, the 55-kg skier slides down the smooth slope for which the shape is…
Q: The figure shows a 200-foot tower on the side of a hill that forms a 5° angle with the horizontal.…
Q: A frame EFG is shown in the figure. All members
Q: #2 TACCCCTCTAATGACAGTACT TRANSCRIPTION mRNA: Protein (amino acid sequence): TRANSLATION
Q: 1) This question explores the energy associated with an electron transition from n = 5 to n = 2. a)…
Q: In python, write a function own_filter where it can flip an image vertically or set an image to a…
Q: The amino acid threonine is one of the common natural building blocks for proteins. Unlike many of…
Q: 6. Buses arrive at ten minute intervals starting at noon. A man arrives at the bus stop a random…
Q: 2. 23 2.2.2 22 2.2 Tarnun adt
Q: Because of the period-luminosity relation for Cepheids and RR Lyrae variable stars, astronomers are…
Q: Rogers Company reported net income of $41,603 for the year. During the year, accounts receivable…
Q: When Dr. Williams applied for his position as Head of Surgery at the new medical center, he supplied…
Q: Define attitudes, differentiating them from beliefs.
Q: The following data set shows a random selection of delivery drivers from a particular pizza…
Q: 1 7) y = = = x + 2 4 y = -x-1 number of solutions