MICROBIOLOGY: EVOLV.SCI.-W/ACCESS>CI<
4th Edition
ISBN: 9780393622805
Author: SLONCZEWSKI
Publisher: Norton custom
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9.4, Problem 1TQ
Summary Introduction
To review:
The retaining of wild-type sequence from the donor by the recipient cell through the mismatch repair process.
Introduction:
Mismatch repair is a process where errors in insertion, deletion, and misincorporation in the base pairs are recognized that may have occurred during replication and recombination. It repairs the DNA (deoxyribonucleic acid) damage. It maintains cellular homeostasis as well as genomic stability. The mismatch repair mechanisms replace or remove the mismatched bases through the insertion or deletion process.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 9 Solutions
MICROBIOLOGY: EVOLV.SCI.-W/ACCESS>CI<
Ch. 9.1 - Prob. 1TQCh. 9.1 - Prob. 2TQCh. 9.1 - Prob. 3TQCh. 9.1 - Prob. 4TQCh. 9.2 - Prob. 1TQCh. 9.3 - Prob. 1TQCh. 9.4 - Prob. 1TQCh. 9.4 - Prob. 2TQCh. 9.5 - Prob. 1TQCh. 9.6 - Prob. 1TQ
Ch. 9 - Prob. 1RQCh. 9 - Prob. 2RQCh. 9 - Prob. 3RQCh. 9 - Prob. 4RQCh. 9 - Prob. 5RQCh. 9 - Prob. 6RQCh. 9 - Prob. 7RQCh. 9 - Prob. 8RQCh. 9 - Prob. 9RQCh. 9 - Prob. 10RQCh. 9 - Prob. 11RQCh. 9 - Prob. 12RQCh. 9 - Prob. 13RQCh. 9 - Prob. 14RQCh. 9 - Prob. 15RQCh. 9 - Prob. 16RQCh. 9 - Prob. 1TQCh. 9 - Prob. 2TQCh. 9 - Prob. 3TQCh. 9 - Prob. 4TQCh. 9 - Prob. 5TQCh. 9 - Prob. 6TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningCase Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
genetic recombination strategies of bacteria CONJUGATION, TRANSDUCTION AND TRANSFORMATION; Author: Scientist Cindy;https://www.youtube.com/watch?v=_Va8FZJEl9A;License: Standard youtube license