Campbell Biology in Focus (2nd Edition)
2nd Edition
ISBN: 9780321962751
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 9.3, Problem 1CC
Summary Introduction
To identify:
The reason why the nuclei resulting from experiment 2 contain different amount of DNA, as refer to Figure: 9.14 “Inquiry”, in the textbook.
Introduction:
With reference to the data in Figure: 9.14 “Inquiry”, in the textbook, the researchers investigated that “a cell’s progression by the cell cycle is controlled by cytoplasmic molecules”.
As given in experiment 2, researchers cause the fusion of M phase with a cell of G1 phase. The G1 phase began to start mitosis. This process resulted in the formation of a spindle and condensation of the chromosomes even though the chromosome had not been duplicated.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10° D. In your
answers, show how you came up to each result?
(a) How many base pairs does this bacterium contain?
(b) How many full double-helical turns does this DNA contain?
(c) How long is this DNA in µm?
You have 2 solutions of DNA. Solution 1 contains single stranded viral DNA while Solution 2 has double stranded form of the same viral DNA. Both solutions contain 1 mg/ml of DNA. You then expose each of these solutions to UV light at 260 nm. Which of the following results would you expect to see after UV light exposure?
a.Neither solution will absorb any UV light but the DNA in both solutions will be broken by the action of the UV light.
b.Solution 1 will absorb less light than Solution 2
c.Solution 1 will absorb more light than solution 2.
d.Nothing will occur. DNA can only absorb UV light if it is interchelated with ethidium bromide.
e.Both solutions will absorb the same amount of light since their concentrations are the same.
In figure 10.16 , how would the curve appear if the GC content of the DNA sample were increased? How would the curve appear if the AT content were increased?
Chapter 9 Solutions
Campbell Biology in Focus (2nd Edition)
Ch. 9.1 - WHAT IF? A chicken has 78 chromosomes in its...Ch. 9.2 - Compare cytokinesis in animal cells and plant...Ch. 9.2 - Prob. 3CCCh. 9.2 - Compare the roles of tubulin and actin during...Ch. 9.3 - Prob. 1CCCh. 9.3 - Prob. 2CCCh. 9.3 - Compare and contrast a benign tumor and a...Ch. 9.3 - Prob. 4CCCh. 9 - Through a microscope, you can see a cell plate...Ch. 9 - In the cells of some organisms, mitosis occurs...
Ch. 9 - Which of the following does not occur during...Ch. 9 - Prob. 4TYUCh. 9 - The drug cytochalasin B blocks the function of...Ch. 9 - DRAW IT Draw one eukaryotic chromosome as it would...Ch. 9 - The light micrograph shows dividing cells near the...Ch. 9 - SCIENTIFIC INQUIRY Although both ends of a...Ch. 9 - FOCUS ON EVOLUTION The result of mitosis is that...Ch. 9 - SYNTHESIZE YOUR KNOWLEDGE Shown here are two He La...Ch. 9 - FOCUS ON INFORMATION The continuity of life is...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Slide 8 Please help me explain this on my report on cell dogmaarrow_forwardYou isolate nuclei from three different eukaryotic species. You treat the samples in exactly the same way (adding same amount of enzyme, buffer and time) to partially digest the chromatin with micrococcal nuclease, separate the DNA from the protein, and run the DNA on an agarose gel. You see the pattern below: Lane 1 2 3 Approximate size of bands (in base pairs) 200, 400, 600, 800 180, 360, 540, 720 190, 380, 570, 760 Knowing that core-DNA in all cell types is the same what is your explanation for the difference in DNA size in the patterns you observe?arrow_forwardSecond, Question 3arrow_forward
- Second, Question 2arrow_forwardImage 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )arrow_forwardWhat allows the peaks to be different colors?arrow_forward
- The line below depicts a DNA segment from a eukaryote. In this case, only the top, coding strand, is shown which is ok for our purposes (but remember that the other strand would also be present in DNAà but it is ok for us to ignore). This is very similar to a problem on the old tests. For each letter state the structure or the function of what occurs at that region. Letter A is Letter B is Letter C is Letter D is Letter E is Letter F is Letter G is To which region/letter would RNA Polymerase bind To which region/letter GTF bind Label the position of the start codon ATG and the stop codon TGA The picture below is for the question itselfarrow_forwardIn Figure 10-14, why does DNA migrate to the anode(+ pole)?arrow_forwardSince DNA is a hydrophillicmoelcule, it cannot pass through cell membranes. Name and explain the technique with which the DNA is forced into (ii) a bacterial cell (ii) a plant cell (iii) an animal cell.arrow_forward
- The table below summarises the three stages of Meselson and Stahl's experiment and their results. (a) Complete the table by drawing, in the appropriate boxes, diagrams of the DNA molecules and mark the position and size of the DNA bands in the tubes. Experimental stage Diagram to show the strands in the DNA Position and size of DNA bands in the tube of molecules of the bacteria separating solution Stage 1 Bacteria grown for several generations in culture medium containing heavy nitrogen Stage 2 The bacteria from the end of stage 1 were grown for another generation in culture medium containing light nitrogen TA2G - Completed forms must be available for Open Awards extermal moderation purposes. Page 7 of 13 Stage 3 The bacteria from the end of stage 2 were grown for one more generation in culture medium containing light nitrogen (b) The bacteria at the end of stage two were grown for five more generations. After each generation, what would you expect to see in the test tube? Draw these…arrow_forwardFor a DNA sequence 5'-CTAAGCCGGAT-3', what is the complementary DNA sequence? Question 6 options: 3'-GAUUCGGCCUA-3' 5'-GATTCGGCCTA-3' Not possible to know given this information. 5'-TAGGCCGAATC-3' 3'-GATTCGGCCTA-5'arrow_forwardA person can't see a single cotton thread for classrooms away. But if you wound thousands of them together into a rope, it'd be visible at the same distance. How is this statement an analogy to the DNA extraction of a strawberry?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning