
Concept explainers
To determine:
The average duration of mitosis.
Introduction:
The process in which a single cell divides into two identical daughter cells is termed as mitosis. In mitosis, parent cell and daughter cells are copy of each other. The main purpose of mitosis is to replace old cells and for growth.

Explanation of Solution
Given data:
Number of cells in interphase − 90
Number of cells in prophase − 13
Number of cells in metaphase − 12
Number of cells in anaphase − 3
Number of cells in telophase − 2
Total cells − 120
Time required by a cell to complete one cycle − 24 hours
Total number of cells in mitotic phase (M phase) = 13+12+3+2 = 30
The ratio of number of cells undergoing mitosis to total number of cells is termed as mitotic index.
Time taken to complete one cell cycle = 24 hours
So, the average duration of mitosis is 36 minutes.
Chapter 9 Solutions
Glencoe Science Biology, Teacher Edition, Hardcover Book Only
Additional Science Textbook Solutions
Campbell Biology (11th Edition)
Introductory Chemistry (6th Edition)
Campbell Biology in Focus (2nd Edition)
Human Anatomy & Physiology (2nd Edition)
Physics for Scientists and Engineers: A Strategic Approach, Vol. 1 (Chs 1-21) (4th Edition)
Cosmic Perspective Fundamentals
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





