
Concept explainers
Chlamydomonas, a eukaryoric green alga, may be sensitive to the antibiotic erythromycin, which inhibits protein synthesis in bacteria. There are two mating types in this alga, mt+ and mt–. If an mt+ cell sensitive to the antibiotic is crossed with an mt– cell that is resistant, all progeny cells are sensitive. The reciprocal cross (mt+ resistant and mt– sensitive) yields all resistant progeny cells. Assuming that the mutation for resistance is in the chloroplast DNA, what can you conclude from the results of these crosses?

To determine: The conclusion that can be drawn from the results of the given crosses.
Introduction: Chlamydomonas is a eukaryotic green alga and shows two mating types mt+ and mt-. The cross between mt+ cell (sensitive to antibiotic) and mt- cell (resistant to antibiotic) produces sensitive progeny cells.
Explanation of Solution
The following conclusions can be drawn from the results of the given crosses:
- The mt+ strain of Chlamydomonas is the donor of the chloroplast DNA. This is because the inheritance of resistance or sensitivity to the antibiotic relies on the status of mt+ gene.
- In Chlamydomonas, the chloroplasts obtain their features from mt+, whereas mitochondria obtain their features from the mt- strain.
Thus, mt+ strain is the donor of chloroplast DNA and the chloroplasts gain their characteristics from mt+. The mitochondria obtain their features from mt-.
Want to see more full solutions like this?
Chapter 9 Solutions
Concepts of Genetics (12th Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College




