
EBK SEELEY'S ANATOMY & PHYSIOLOGY
11th Edition
ISBN: 9781259671166
Author: VanPutte
Publisher: MCGRAW HILL BOOK COMPANY
expand_more
expand_more
format_list_bulleted
Question
Chapter 8.5, Problem 23AYP
Summary Introduction
To analyze:
The factors that contribute to wearing down the cartilages in old aged people.
Introduction:
Synovial joints contain synovial fluid and this joint mostly articulates the bones of the appendicular skeleton. These bones are covered with hyaline cartilage called articular cartilage and a sheet of fibrocartilage is present between articular cartilage called articular disk. The cartilage is mainly composed of protein and supports more flexibility and strength.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 8 Solutions
EBK SEELEY'S ANATOMY & PHYSIOLOGY
Ch. 8.1 - What two standards are used to classify joints?...Ch. 8.1 - What are the characteristics of a fibrous joint?...Ch. 8.1 - What is a synostosis? How does it differ from a...Ch. 8.1 - Name the two types of cartilaginous joints, tell...Ch. 8.1 - Prob. 5AYPCh. 8.1 - Prob. 6AYPCh. 8.1 - Prob. 7AYPCh. 8.1 - On what basis are synovial joints classified? List...Ch. 8.1 - What directional movements are permitted at each...Ch. 8.2 - Describe flexion and extension. How are they...
Ch. 8.2 - Prob. 11AYPCh. 8.2 - Prob. 12AYPCh. 8.2 - Prob. 13AYPCh. 8.2 - Describe opposition and reposition of the thumb.Ch. 8.2 - Prob. 15AYPCh. 8.3 - What is range of motion? Contrast active and...Ch. 8.3 - Prob. 17AYPCh. 8.4 - Prob. 18AYPCh. 8.4 - Prob. 19AYPCh. 8.4 - Explain the differences in stability and movement...Ch. 8.4 - List the common knee injuries, and tell which port...Ch. 8.4 - Prob. 22AYPCh. 8.5 - Prob. 23AYPCh. 8.5 - Describe the age-related factors that cause loss...Ch. 8.5 - Prob. 25AYPCh. 8 - Which of these joints is not matched with the...Ch. 8 - Prob. 2RACCh. 8 - Prob. 3RACCh. 8 - Prob. 4RACCh. 8 - Prob. 5RACCh. 8 - Prob. 6RACCh. 8 - Which of these joints is correctly matched with...Ch. 8 - Prob. 8RACCh. 8 - Prob. 9RACCh. 8 - Prob. 10RACCh. 8 - Prob. 11RACCh. 8 - Prob. 12RACCh. 8 - For a ballet dancer to stand on her toes, her feet...Ch. 8 - Prob. 14RACCh. 8 - A lip (labrum) of fibro cartilage deepens the...Ch. 8 - Prob. 16RACCh. 8 - Prob. 17RACCh. 8 - Prob. 18RACCh. 8 - Prob. 19RACCh. 8 - How would body function be affected if the sterna...Ch. 8 - Prob. 2CTCh. 8 - For each of the following muscles, describe the...Ch. 8 - Prob. 4CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
The Skeletal System; Author: Professor Dave Explains;https://www.youtube.com/watch?v=f-FF7Qigd3U;License: Standard YouTube License, CC-BY