MICROBIOLOGY W/ACCESS
4th Edition
ISBN: 9781266808685
Author: Cowan
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 8.3, Problem 2CF
Summary Introduction
To explain:
Advantages and disadvantages of producing bio-fuels.
Concept Introduction:
Biofuels are prepared by the anaerobic fermentation of plant and animal waste material. Carbon dioxide gas is produced as a byproduct in this reaction. It can be produced from oils and fats by the process of transesterification. Various subtrates for biofuel production include lignocellulose, vegetable oil and complex carbohydrates. The process of fermentation produces gases like hydrogen, oxygen and carbon-dioxide along with methane. Ethanol, butanol and propanol are also produced as products during fermentation of carbohydrate material.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 8 Solutions
MICROBIOLOGY W/ACCESS
Ch. 8.1 - Describe the relationship among metabolism,...Ch. 8.1 - Fully discuss the structure and function of...Ch. 8.1 - Differentiate between an apoenzyme and a...Ch. 8.1 - Differentiate between an endoenzyme and an...Ch. 8.1 - Diagram the four major patterns of metabolism.Ch. 8.1 - Describe how enzymes are controlled.Ch. 8.2 - Name the chemical in which energy is stored in...Ch. 8.2 - Create a general diagram of a redox reaction.Ch. 8.2 - Identify electron carriers used by cells.Ch. 8.3 - Prob. 2CF
Ch. 8.3 - List three basic catabolic pathways and the...Ch. 8.3 - Construct a paragraph summarizing glycolysis.Ch. 8.3 - Describe the Krebs cycle and compare the process...Ch. 8.3 - Discuss the significance of the electron transport...Ch. 8.3 - State two ways in which anaerobic respiration...Ch. 8.3 - Summarize the steps of microbial fermentation and...Ch. 8.3 - Prob. 16AYPCh. 8.4 - Prob. 17AYPCh. 8.4 - Define amphibolism.Ch. 8.5 - Summarize the overall process of photosynthesis in...Ch. 8.5 - Discuss the relationship between light-dependent...Ch. 8.5 - Explain the role of the Calvin cycle in the...Ch. 8 - Prob. 1CFCh. 8 - Prob. 1MCQCh. 8 - An enzyme a. becomes part of the final products....Ch. 8 - An apoenzyme is where the ____ is located. a....Ch. 8 - Many coenzymes are a. metals. b. vitamins. c....Ch. 8 - Prob. 5MCQCh. 8 - Energy is carried from catabolic to anabolic...Ch. 8 - A product or products of glycolysis is/are a. ATP....Ch. 8 - Prob. 8MCQCh. 8 - Complete oxidation of glucose in aerobic...Ch. 8 - ATP synthase complexes can generate ______ ATP(s)...Ch. 8 - True-False Questions. If the statement is true,...Ch. 8 - An enzyme lowers the activation energy required...Ch. 8 - One cycle of fermentation yields more energy than...Ch. 8 - Energy in biological systems is primarily...Ch. 8 - Exoenzymes are produced outside the cell.Ch. 8 - Prob. 1CTQCh. 8 - Prob. 2CTQCh. 8 - Prob. 3CTQCh. 8 - Prob. 4CTQCh. 8 - Prob. 5CTQCh. 8 - Prob. 6CTQCh. 8 - Prob. 7CTQCh. 8 - Prob. 8CTQCh. 8 - Prob. 9CTQCh. 8 - Provide evidence in support of or refuting the...Ch. 8 - Prob. 1CCCh. 8 - Prob. 2CCCh. 8 - Prob. 3CCCh. 8 - From chapter 4, figure 4.16. On the enlarged...Ch. 8 - Using the words that follow, please create a...
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education