
Human Anatomy & Physiology, Modified Mastering A&P with eText and Value Pack Access Card and Practicing A&P Workbook for Human Anatomy & Physiology
1st Edition
ISBN: 9780134206189
Author: Erin C. Amerman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 8.2, Problem 2QC
Summary Introduction
To review:
The definition of gomphosis and its location in the human body.
Introduction:
When the short collagen fibers of dense regular collagenous connective tissue get interlinked with each other, then fibrous joints are formed. They provide stability to bones, and there are no spaces between these joints.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 8 Solutions
Human Anatomy & Physiology, Modified Mastering A&P with eText and Value Pack Access Card and Practicing A&P Workbook for Human Anatomy & Physiology
Ch. 8.1 - 2. How are joints classified functionally?
Ch. 8.1 - How are joints classified structurally?Ch. 8.2 - Prob. 1QCCh. 8.2 - Prob. 2QCCh. 8.2 - 3. What is a syndesmosis? Where are syndesmoses...Ch. 8.3 - What are the features of a synchondrosis?Ch. 8.3 - 2. Where is the pubic symphysis located? (p. 247)
Ch. 8.3 - Describe the general features of a symphsis.Ch. 8.3 - What are two examples of symphyses?Ch. 8.4 - What are the layers of the articular capsule, and...
Ch. 8.4 - What functions are served by synovial fluid?Ch. 8.4 - 3. Which type of cartilage makes up articular...Ch. 8.4 - 4. Why do synovial joints require stabilization?
Ch. 8.4 - 5. What are the basic structural and functional...Ch. 8.4 - What is osteoarthritis, and in what age group...Ch. 8.5 - Compare and contrast: gliding and angular motions,...Ch. 8.6 - 1. Compare the six structural classes of synovial...Ch. 8.6 - Which type of synovial joint has the greatest...Ch. 8.6 - 3. What two joints form the elbow joint?
Ch. 8.6 - Describe four ligaments that stabilize the knee...Ch. 8.6 - Prob. 5QCCh. 8.6 - What features increase the stability of the...Ch. 8.6 - Which bones articulate to form the hip joint?Ch. 8.6 - 8. Why is the shoulder joint less stable than the...Ch. 8 - Which of the following is not a function of...Ch. 8 - 2. Which functional joint class includes freely...Ch. 8 - Identify each of the following joints as synovial,...Ch. 8 - In general, when mobility of a joint _____, its...Ch. 8 - 5. Mark the following statements as true or...Ch. 8 - Fill in the blanks: The articulating ends of bones...Ch. 8 - 7. What is/are the function(s) of synovial...Ch. 8 - 8. Which of the following correctly describes the...Ch. 8 - Bone movement at a joint is described around an...Ch. 8 - Match the following terms with the correct...Ch. 8 - Define each of the following movements or movement...Ch. 8 - Mark the following statements as true or false. If...Ch. 8 - 13. Which of the following best describes the...Ch. 8 - The structure that stabilizes the shoulder joint...Ch. 8 - 15. Which factors contribute to the stability of...Ch. 8 - 1. Explain how the structure of each of the...Ch. 8 - 2. The primary action of the biceps brachii...Ch. 8 - Some individuals have an abnormally small and...Ch. 8 - 1. Some health practitioners claim that the...Ch. 8 - 2. Lauren has hurt her knee playing soccer. She...Ch. 8 - When articular cartilage is damaged, often...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning