
Human Anatomy (8th Edition) - Standalone book
8th Edition
ISBN: 9780321883322
Author: Frederic H. Martini, Robert B. Tallitsch
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 8, Problem 9RC
Summary Introduction
To review:
The cause of the decrease in height in the older age.
Introduction:
The human vertebral column contains a fibrocartilaginous symphysis, which is present in between two adjacent vertebrae. This is called intervertebral disc. The main functions of this disc is to help in movement of vertebrae, separate one vertebrae from another, and the transmission of load from one vertebra to another.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 8 Solutions
Human Anatomy (8th Edition) - Standalone book
Ch. 8 - Match each numbered item with the most closely...Ch. 8 - Match each numbered item with the most closely...Ch. 8 - Prob. 2RFTCh. 8 - Prob. 4RFTCh. 8 - Prob. 5RFTCh. 8 - Prob. 6RFTCh. 8 - Prob. 7RFTCh. 8 - Prob. 8RFTCh. 8 - Prob. 9RFTCh. 8 - The function of a bursa is to (a) reduce friction...
Ch. 8 - Prob. 11RFTCh. 8 - 12. Match each diagram to the right to the...Ch. 8 - Prob. 13RFTCh. 8 - Label the following structures on the diagram of a...Ch. 8 - Prob. 15RFTCh. 8 - Prob. 16RFTCh. 8 - Prob. 1RCCh. 8 - Prob. 2RCCh. 8 - How do the malleoli of the tibia and fibula...Ch. 8 - Prob. 4RCCh. 8 - Prob. 5RCCh. 8 - 6. What role do capsular ligaments play in a...Ch. 8 - Prob. 7RCCh. 8 - How can pronation be distinguished from...Ch. 8 - Prob. 9RCCh. 8 - When a person involved in an automobile accident...Ch. 8 - Prob. 2CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Nutrition Through The Life CycleHealth & NutritionISBN:9781337919333Author:Brown, Judith E.Publisher:Cengage Learning,
- Lifetime Physical Fitness & WellnessHealth & NutritionISBN:9781337677509Author:HOEGERPublisher:Cengage

Nutrition Through The Life Cycle
Health & Nutrition
ISBN:9781337919333
Author:Brown, Judith E.
Publisher:Cengage Learning,
Lifetime Physical Fitness & Wellness
Health & Nutrition
ISBN:9781337677509
Author:HOEGER
Publisher:Cengage
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY