
Biology: Concepts and Investigations
5th Edition
ISBN: 9781260542202
Author: Marielle Hoefnagels
Publisher: Mcgraw-hill Higher Education (us)
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 8, Problem 2MCQ
Summary Introduction
Introduction:
Binary fission is a type of asexual reproduction, which mostly occurs in prokaryotes such as bacteria. In this, an organism duplicates its genetic material and then divides into two parts.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 8 Solutions
Biology: Concepts and Investigations
Ch. 8.1 - Explain the roles of mitotic cell division,...Ch. 8.1 - Prob. 2MCCh. 8.2 - Prob. 1MCCh. 8.2 - Prob. 2MCCh. 8.2 - Prob. 3MCCh. 8.2 - Prob. 4MCCh. 8.3 - Which cell types divide by binary fission?Ch. 8.3 - Prob. 2MCCh. 8.4 - Prob. 1MCCh. 8.4 - Prob. 2MC
Ch. 8.5 - Prob. 1MCCh. 8.5 - Prob. 2MCCh. 8.5 - Prob. 3MCCh. 8.5 - Prob. 4MCCh. 8.5 - Distinguish between mitosis and cytokinesis.Ch. 8.6 - Prob. 1MCCh. 8.6 - Prob. 2MCCh. 8.6 - Prob. 3MCCh. 8.6 - Prob. 4MCCh. 8.6 - Prob. 5MCCh. 8.7 - Prob. 1MCCh. 8.7 - Prob. 2MCCh. 8.8 - Prob. 1MCCh. 8.8 - Prob. 2MCCh. 8 - A DNA molecule is placed in a test tube containing...Ch. 8 - Prob. 2MCQCh. 8 - Prob. 3MCQCh. 8 - Prob. 4MCQCh. 8 - Prob. 5MCQCh. 8 - Prob. 1WIOCh. 8 - Write and explain an analogy for each of these DNA...Ch. 8 - Obtain a rubber band and twist it as m any times...Ch. 8 - Sketch and describe the events that occur when a...Ch. 8 - Prob. 5WIOCh. 8 - List the ways that binary fission is similar to...Ch. 8 - Prob. 7WIOCh. 8 - Prob. 8WIOCh. 8 - Prob. 9WIOCh. 8 - Prob. 1PITCh. 8 - Prob. 2PITCh. 8 - Prob. 3PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning


Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
The Cell Cycle and its Regulation; Author: Professor Dave Explains;https://www.youtube.com/watch?v=eqJqhA8HSJ0;License: Standard YouTube License, CC-BY
Cell Division - Mitosis and Meiosis - GCSE Biology (9-1); Author: Mr Exham Biology;https://www.youtube.com/watch?v=w7vp_uRA8kw;License: Standard YouTube License, CC-BY