Introduction:
Paranasal sinuses are a group of air-filled spaces which are surrounded in the nasal cavity. Human possess four paired paranasal sinuses. The maxillary sinus located under the eyes, the frontal sinuses are above the eyes. The ethmoidal sinuses are between the eyes and the sphenoidal sinuses are behind the eyes.

Answer to Problem 1TYR
Correct answer:
From the list of choice, temporal, is the correct answers, that is option (b)
Explanation of Solution
Justify reasons for the correct statement:
Temporal bone is not the sinus bone, which is situated at the sides and base of the skull
Option (b) is given as temporal
Hence, the correct answer is Option (b) temporal
Justify reasons for the incorrect statements:
Option (a) frontal
Frontal sinuses are located above the eyes, so this is not the correct answer.
Option (c) sphenoid
Sphenoid sinuses are located behind the eyes, so this is not the correct answer.
Option (d) ethmoid
Ethmoid sinuses are located between the eyes, so this is not the correct answer.
Option (e) maxillary
Maxillary sinuses are located under the eyes, so this is not the correct answer.
Hence the option (a), (c), (d) and (e) is incorrect.
Want to see more full solutions like this?
Chapter 8 Solutions
A&P UNITY AND FUNCTION ACCESS
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:CengageComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning


