Concept explainers
(i)
To create:
The frame shift mutation from the DNA sequence: TAC CAG ATA CAC TCC CCT
Introduction:
The mutation which occurs in introns is insertion or deletion. It can cause shift in open reading frame of the gene sequence, and can change the amino acid sequence of the coded protein.
(i)

Explanation of Solution
Change in the genetic sequence of DNA, by addition and deletion of nucleotides, results in gene mutation.
Insertion mutation: This mutation occurs by insertion of one or more nucleotides in the DNA sequence. Insertion mutation is a type of frame shift mutation, as insertion of a single
Original DNA sequence:
Frame shift due to insertion mutation:
Deletion mutation: This mutation occurs due to removal of one or more nucleotides from DNA sequence. Deletion mutation is a type of frame shift mutation, as removal of a single nucleotide shifts the whole reading frame in the DNA.
Original DNA sequence:
Frame shift due to deletion mutation:
(ii)
To create:
The silent mutation from the DNA sequence: TAC CAG ATA CAC TCC CCT
Introduction:
The mutations in the codons that do not change the particular amino acid in the given polypeptide chain are called synonymous mutations. They are also called silent mutations because they cause no change in the structure of the protein.
(ii)

Explanation of Solution
Silent mutation involves base substitution which results in same amino acids that was encoded by previous nucleotidal sequence.
Original DNA sequence:
Corresponding RNA sequence:
Amino acid sequence: Tyrosine Glutamine Methionine Histidine Serine Proline
Silent mutation:
Corresponding RNA sequence:
Amino acid sequence: Tyrosine Glutamine Methionine Histidine Serine Proline
(iii)
To create:
The nonsense mutation from the DNA sequence: TAC CAG ATA CAC TCC CCT
Introduction:
The nonsense mutations are the mutations that generate the stop codon. The generated stop codon terminates the translational process and thus, the protein structure will not be formed because no more amino acids will be added to the sequence.
(iii)

Explanation of Solution
Nonsense mutation involves substitution of a single base pair that yields a stop codon.
Original DNA sequence:
Nonsense mutation:
Corresponding RNA sequence:
Want to see more full solutions like this?
Chapter 8 Solutions
CONNECT WITH LEARNSMART FOR COWAN: MICR
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax





