CONNECT WITH LEARNSMART FOR COWAN: MICR
3rd Edition
ISBN: 2818440123740
Author: Cowan
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 8, Problem 13Q
Summary Introduction
Introduction:
Horizontal gene transfer is a process through which an organism can incorporate DNA of other organism. It is common in bacteria and viruses and involves three steps: transduction, conjugation, and translation.
Expert Solution & Answer

Trending nowThis is a popular solution!

Students have asked these similar questions
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Chapter 8 Solutions
CONNECT WITH LEARNSMART FOR COWAN: MICR
Ch. 8.1 - Define the terms genome and gene.Ch. 8.1 - Differentiate between genotype and phenotype.Ch. 8.1 - Draw a segment of DNA, labeling all important...Ch. 8.1 - Summarize the steps of bacterial DNA replication,...Ch. 8.1 - Compare and contrast the synthesis of leading and...Ch. 8.1 - Prob. 1NPCh. 8.2 - Provide an overview of the relationship among DNA,...Ch. 8.2 - Identify important structural and functional...Ch. 8.2 - Draw a picture of the process of transcription.Ch. 8.2 - List the three types of RNA directly involved in...
Ch. 8.2 - Prob. 10AYPCh. 8.2 - Identify the locations of the promoter, the start...Ch. 8.2 - Indicate how eukaryotic transcription and...Ch. 8.2 - NCLEX PREP 2. The following are all true of RNA,...Ch. 8.2 - Prob. 3NPCh. 8.3 - Define the term operon, and explain one advantage...Ch. 8.3 - Prob. 14AYPCh. 8.4 - Prob. 15AYPCh. 8.4 - Prob. 16AYPCh. 8.5 - Prob. 17AYPCh. 8.5 - Differentiate among frameshift, nonsense, silent,...Ch. 8.5 - Prob. 19AYPCh. 8.5 - Prob. 1MMCh. 8.6 - Explain the importance of restriction...Ch. 8.6 - List the steps in the polymerase chain reaction.Ch. 8.6 - Describe how you can clone a gene into a...Ch. 8.6 - Prob. 23AYPCh. 8.6 - Prob. 24AYPCh. 8.6 - Name two genetic techniques that are designed to...Ch. 8.6 - NCLEX PREF 4. A client is being treated with...Ch. 8.6 - Prob. 2MMCh. 8 - Single nucleotide polymorphisms are found in a....Ch. 8 - Using your knowledge of DNA from this chapter,...Ch. 8 - Conduct research on CRISPR and explain in...Ch. 8 - Which of the following is a characteristic of RNA?...Ch. 8 - List some advantages and disadvantages to a cell...Ch. 8 - Construct an argument for why tRNA contains a lot...Ch. 8 - Prob. 7QCh. 8 - Discuss the intersection between the metabolome...Ch. 8 - Defend this statement: All of biology is dependent...Ch. 8 - DNA is semiconservative because the ______ strand...Ch. 8 - Examine the DNA triplets here and determine the...Ch. 8 - Prob. 12QCh. 8 - Prob. 13QCh. 8 - Prob. 14QCh. 8 - Metagenomics is providing insight into the...Ch. 8 - The creation of biological molecules and cells...Ch. 8 - Prob. 17QCh. 8 - Genetically modified organisms (GMOs)especially in...Ch. 8 - Prob. 19QCh. 8 - Construct an analogy using your clothes closet to...Ch. 8 - Prob. 21QCh. 8 - Prob. 1VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning


Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
genetic recombination strategies of bacteria CONJUGATION, TRANSDUCTION AND TRANSFORMATION; Author: Scientist Cindy;https://www.youtube.com/watch?v=_Va8FZJEl9A;License: Standard youtube license