Initially turbidity count was used as a parameter to assess the population growth. The demerit of this method was that it could evaluate the relative amount of growth, but the quantitative evaluation could not be done.

Question

Want to see the full answer?

Answer 1

Question

Chapter 7.6, Problem 26ELO

Summary Introduction

Introduction:

Initially turbidity count was used as a parameter to assess the population growth. The demerit of this method was that it could evaluate the relative amount of growth, but the quantitative evaluation could not be done.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?

Answer 2

Question

Chapter 7.6, Problem 26ELO

Summary Introduction

Introduction:

Initially turbidity count was used as a parameter to assess the population growth. The demerit of this method was that it could evaluate the relative amount of growth, but the quantitative evaluation could not be done.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 7.6, Problem 26ELO

Summary Introduction

Introduction:

Initially turbidity count was used as a parameter to assess the population growth. The demerit of this method was that it could evaluate the relative amount of growth, but the quantitative evaluation could not be done.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 7.6, Problem 26ELO

Summary Introduction

Introduction:

Initially turbidity count was used as a parameter to assess the population growth. The demerit of this method was that it could evaluate the relative amount of growth, but the quantitative evaluation could not be done.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 7.6, Problem 26ELO

Summary Introduction

Introduction:

Initially turbidity count was used as a parameter to assess the population growth. The demerit of this method was that it could evaluate the relative amount of growth, but the quantitative evaluation could not be done.

Answer 6

Chapter 7.6, Problem 26ELO

Summary Introduction

Introduction:

Initially turbidity count was used as a parameter to assess the population growth. The demerit of this method was that it could evaluate the relative amount of growth, but the quantitative evaluation could not be done.

Answer 7

Chapter 7.6, Problem 26ELO

Summary Introduction

Introduction:

Initially turbidity count was used as a parameter to assess the population growth. The demerit of this method was that it could evaluate the relative amount of growth, but the quantitative evaluation could not be done.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 7.1 - 1. Describe the major environmental factors to...Ch. 7.1 - 2. Define nutrition and nutrients and their...Ch. 7.1 - 3. Differentiate between organic and inorganic...Ch. 7.1 - Prob. 4ELO Ch. 7.1 - Prob. 1CYP Ch. 7.1 - Prob. 2CYP Ch. 7.1 - 3. List the general functions of the essential...Ch. 7.1 - 4. Define growth factors and metallic ions with...Ch. 7.2 - 5. Describe the main categories of nutritional...Ch. 7.2 - 6. Distinguish different types of autotrophs and...

Initially turbidity count was used as a parameter to assess the population growth. The demerit of this method was that it could evaluate the relative amount of growth, but the quantitative evaluation could not be done.

Solution Summary: The author explains that total cell count and flow cytometry can be used for detecting and counting cells in a culture.

Videos

Introduction:

Initially turbidity count was used as a parameter to assess the population growth. The demerit of this method was that it could evaluate the relative amount of growth, but the quantitative evaluation could not be done.

Want to see the full answer?

Chapter 7 Solutions

Initially turbidity count was used as a parameter to assess the population growth. The demerit of this method was that it could evaluate the relative amount of growth, but the quantitative evaluation could not be done.

Solution Summary: The author explains that total cell count and flow cytometry can be used for detecting and counting cells in a culture.

Videos

Introduction: Initially turbidity count was used as a parameter to assess the population growth. The demerit of this method was that it could evaluate the relative amount of growth, but the quantitative evaluation could not be done.

Want to see the full answer?

Chapter 7 Solutions

Introduction:

Initially turbidity count was used as a parameter to assess the population growth. The demerit of this method was that it could evaluate the relative amount of growth, but the quantitative evaluation could not be done.