Pearson eText Bauman Microbiology with Diseases by Body Systems -- Instant Access (Pearson+)
5th Edition
ISBN: 9780135891018
Author: ROBERT BAUMAN
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 7, Problem 25MC
Summary Introduction
Introduction:
The trp operon is a type of operon and it consists of a set of genes that codes for the tryptophan production. It is polycistroni in nature. Thus, it consists of a promoter, operator, and five genes coding for the enzymes associated with the tryptophan synthesis.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
As trytophan levels increase in the cell, _____ bind(s) to active aporepressors, causing ______ of tryptophan operon.
a.
inducers, negative regulation
b.
repressors, co-repressing
c.
tryptophan, negative regulation
d.
tryptophan, positive regulation
e.
B-lactose, negative regulation
In prokaryotes, structural proteins in a single biochemical pathway are usually found as a(n) ________ within the genome.
a.
cluster
b.
polycistronic transcript
c.
operon
In prokaryotes, the trp operon is under ________ that ________ prevents RNA polymerase from binding.
a.
negative regulation; biochemically
b.
negative regulation; physically
c.
positive regulation; biochemically
Chapter 7 Solutions
Pearson eText Bauman Microbiology with Diseases by Body Systems -- Instant Access (Pearson+)
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - Vibrio vulnificus Infection Greg enjoyed Floridas...Ch. 7 - Prob. 2TMWCh. 7 - Prob. 3TMWCh. 7 - Why is the genetic ancestry of microbes much more...Ch. 7 - Prob. 1CCSCh. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - A plasmid is ___________. a. a molecule of RNA...Ch. 7 - Prob. 4MC
Ch. 7 - Prob. 5MCCh. 7 - Which of the following molecules functions as a...Ch. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - The Ames test ___________. a. uses auxotrophs and...Ch. 7 - Which of the following methods of DNA repair...Ch. 7 - Prob. 11MCCh. 7 - Prob. 12MCCh. 7 - Which of the following statements is true? a....Ch. 7 - Prob. 14MCCh. 7 - Although two cells are totally unrelated, one cell...Ch. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Before mutations can affect a population...Ch. 7 - Prob. 25MCCh. 7 - Fill in the Blanks 1. The three steps in RNA...Ch. 7 - Fill in the Blanks 2. A triplet of mRNA...Ch. 7 - Fill in the Blanks 3. Three effects of point...Ch. 7 - Fill in the Blanks 4. Insertions and deletions in...Ch. 7 - Fill in the Blanks 5. An operon consists of...Ch. 7 - Prob. 6FIBCh. 7 - Prob. 7FIBCh. 7 - Fill in the Blanks 8. A gene for antibiotic...Ch. 7 - Fill in the Blanks 9. ______ are nucleotide...Ch. 7 - Fill in the Blanks 10. ____________ is a...Ch. 7 - Fill in the Blanks 11.________ RNA carries amino...Ch. 7 - Fill in the Blanks 12. ______ RNA and ______ RNA...Ch. 7 - How does the genotype of a bacterium determine its...Ch. 7 - List several ways in which eukaryotic messenger...Ch. 7 - Compare and contrast intrans and exons.Ch. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Describe the operon model of gene regulation.Ch. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Describe the formation and function of mRNA, rRNA,...Ch. 7 - Prob. 9SACh. 7 - Explain the central dogma of genetics.Ch. 7 - Compare and contrast the processes of...Ch. 7 - Fill in the following table:Ch. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - The drugs ddC and AZT are used to treat AIDS....Ch. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Explain why an insertion of three nucleotides is...Ch. 7 - How could scientists use siRNA to turn off a...Ch. 7 - Prob. 5CTCh. 7 - Prob. 6CTCh. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Corynebacterium diphtheriae, the causative agent...Ch. 7 - Prob. 10CTCh. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Hydrogen bonds between complementary nucleotides...Ch. 7 - On average, RNA polymerase makes one error for...Ch. 7 - We have seen that wobble makes the genetic code...Ch. 7 - If a scientist synthesizes a DNA molecule with the...Ch. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Suppose you want to insert into your dog a gene...Ch. 7 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of these BEST DESCRIBE tryptophan in the Trp Operon? A. Acts as a corepressor B. Acts as a coactivator C. Acts as an inducer D. Acts as an enhancerarrow_forwardA repressor is a __________ that _________ transcription. a. small effector molecule, inhibits b. small effector molecule, enhances c. regulatory protein, inhibits d. regulatory protein, enhancesarrow_forwardOperons______ . a. only occur in bacteria b. include multiple genes c. involve selective gene expressionarrow_forward
- Transcription factors include ______________. a. silencers and enhancers b. promoters and insulators c. activators, repressors, and translational factors d. activators and repressors e. enhancers and repressorsarrow_forwardProkaryotes are lacking in their DNA sequence. A. introns В. еxons. C. promoter sites D. operonsarrow_forwardIn the trp operon, tryptophan is best characterized as being a: A. repressor B. inducer C. corepressor D. DNA-binding domainarrow_forward
- A biologist develops a new drug that seems to dramatically slow the onset of symptoms resulting from HIV infection. Close monitoring of HIV-infected cells reveals that the viral proteins are in the form of long polyproteins. What kind of drug did the biologist develop? A. It is a glycosyl transferase inhibitor. B. It is an integrase inhibitor C. It is a protease inhibitor. D. It is a CD4 inhibitor. please explain why which answer is correct and which is wrong and whyarrow_forwardCertain introns can self-excise from RNA. a. false b. truearrow_forwardWhich of the following order of events correctly depicts the Central Dogma as it would occur in an eukaryotic organism? a. DNA --> Protein --> mRNA b. DNA --> Pre-mRNA --> mRNA --> Protein c. mRNA --> DNA --> Protein d. Protein --> DNA --> Pre-mRNA --> mRNA e. DNA --> mRNA --> Proteinarrow_forward
- Define the following terms: a. promoter b. consensus sequence c. operon d. chromatin-remodeling complex e. general transcription factorsarrow_forwardOne strategy for producing a protein in the milk of a cow is toplace the coding sequence of the gene of interest next to a__________ and then inject the gene into a _________.a. lac operon promoter, cow oocyteb. β-lactoglobulin promoter, cow oocytec. lac operon promoter, cow mammary celld. β-lactoglobulin promoter, cow mammary cellarrow_forwardwhich of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY