Pearson eText Bauman Microbiology with Diseases by Body Systems -- Instant Access (Pearson+)
5th Edition
ISBN: 9780135891018
Author: ROBERT BAUMAN
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7, Problem 15CT
If a scientist synthesizes a DNA molecule with the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
If a scientist synthesizes a DNA molecule with a nucleotide base sequence to TACGGGGGAGGGGGAGGGGGA transcription and translation what would be the amino acid sequence of the product?
Transcribe the following DNA sequence. Then translate the resulting mRNA transcript.
GGACTACGTTCAAAAGCCATGGATTCGGTA
Transcription:
Translation:
What would be the result of the following mutations in the DNA sequence above? How would the polypeptide change? How would you characterize this mutation? (Nucleotides are numbered from left to right.)
a) nucleotide number 16 changes from a G to an A
b) nucleotide number 12 changes from an A to a T
c) nucleotide number 8 changes from a G to an A
d) an insertion of a C between nucleotides 14 and 15.
Translation of the dna sequence AAGCTGGGA would result in:
A) a DNA strand with the base sequence TTCGACCCT
B) an mRNA strand with the sequence TTCGACCCT
C) a sequence of three amino acids linked by peptide bonds
D) an mRNA strand with the sequence UUGCACCCU
Chapter 7 Solutions
Pearson eText Bauman Microbiology with Diseases by Body Systems -- Instant Access (Pearson+)
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - Vibrio vulnificus Infection Greg enjoyed Floridas...Ch. 7 - Prob. 2TMWCh. 7 - Prob. 3TMWCh. 7 - Why is the genetic ancestry of microbes much more...Ch. 7 - Prob. 1CCSCh. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - A plasmid is ___________. a. a molecule of RNA...Ch. 7 - Prob. 4MC
Ch. 7 - Prob. 5MCCh. 7 - Which of the following molecules functions as a...Ch. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - The Ames test ___________. a. uses auxotrophs and...Ch. 7 - Which of the following methods of DNA repair...Ch. 7 - Prob. 11MCCh. 7 - Prob. 12MCCh. 7 - Which of the following statements is true? a....Ch. 7 - Prob. 14MCCh. 7 - Although two cells are totally unrelated, one cell...Ch. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Before mutations can affect a population...Ch. 7 - Prob. 25MCCh. 7 - Fill in the Blanks 1. The three steps in RNA...Ch. 7 - Fill in the Blanks 2. A triplet of mRNA...Ch. 7 - Fill in the Blanks 3. Three effects of point...Ch. 7 - Fill in the Blanks 4. Insertions and deletions in...Ch. 7 - Fill in the Blanks 5. An operon consists of...Ch. 7 - Prob. 6FIBCh. 7 - Prob. 7FIBCh. 7 - Fill in the Blanks 8. A gene for antibiotic...Ch. 7 - Fill in the Blanks 9. ______ are nucleotide...Ch. 7 - Fill in the Blanks 10. ____________ is a...Ch. 7 - Fill in the Blanks 11.________ RNA carries amino...Ch. 7 - Fill in the Blanks 12. ______ RNA and ______ RNA...Ch. 7 - How does the genotype of a bacterium determine its...Ch. 7 - List several ways in which eukaryotic messenger...Ch. 7 - Compare and contrast intrans and exons.Ch. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Describe the operon model of gene regulation.Ch. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Describe the formation and function of mRNA, rRNA,...Ch. 7 - Prob. 9SACh. 7 - Explain the central dogma of genetics.Ch. 7 - Compare and contrast the processes of...Ch. 7 - Fill in the following table:Ch. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - The drugs ddC and AZT are used to treat AIDS....Ch. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Explain why an insertion of three nucleotides is...Ch. 7 - How could scientists use siRNA to turn off a...Ch. 7 - Prob. 5CTCh. 7 - Prob. 6CTCh. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Corynebacterium diphtheriae, the causative agent...Ch. 7 - Prob. 10CTCh. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Hydrogen bonds between complementary nucleotides...Ch. 7 - On average, RNA polymerase makes one error for...Ch. 7 - We have seen that wobble makes the genetic code...Ch. 7 - If a scientist synthesizes a DNA molecule with the...Ch. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Suppose you want to insert into your dog a gene...Ch. 7 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Using the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G mRNA: Codon: Anticodon: Amino Acids:arrow_forwardUsing the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence.arrow_forwardTranscribe the following strand in Mrna, then translate it into amino acidsarrow_forward
- Which of the following is NOT true regarding the genetic code and translation? a) An mRNA is typically translated in only 1 reading frame. b) There are 64 different codons. c) Multiple amino acids may be coded for by a single codon. d) mRNA sequence is the reverse complement of the template strand of DNA.arrow_forwardThe sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. ССТАССТТАТGCСАAGTTGGGGATАААСТС The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is th v end. 5' Please answer all parts of the question. carboxyl 3' aminoarrow_forwardThe following is the base sequence on the coding strand of a DNA molecule. AAT GCC AGT GGT TCG CAC Rewrite the base sequence above and underneath write the base sequence for the template DNA strand. Write the base sequence for the strand of mRNA transcribed from the original strand of DNA or template strand. Remember transcribing means making mRNA from DNA. Write the amino acid sequence translated from this mRNA. Translating means making an amino acid chain from mRNA. A) If the fourth nucleotide in the coding DNA strand was changed from a G to a C, what would be the base sequence of the new strand of mRNA? b) What would the resulting amino acid fragment be? A) If a G were added to the coding DNA strand after the third nucleotide, what would be the base sequence of the resulting mRNA? B) What would the resulting amino acid fragment be?arrow_forward
- In cells, proteins are synthesized from a gene sequence via the process of transcription and translation. Which of the following complementary base pairings would you observe during the synthesis (the making) of a prokaryotic protein? [I am looking for the complementary base pairing(s) you would see as you go from a gene to a protein. Note that it is prokarryotic protein and not eukaryotic protein]. DNA with mRNA mRNA with tRNA mRNA with rRNA rRNA with tRNA A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correctarrow_forwardA strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.arrow_forwardTranslate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forward
- In your own wordsarrow_forward6a) Transcribe the following DNA sequence into codons. TACGCGACATTACATGAATCGTTTGGAGATTAGCCCTATTTCTCTAAGAACACGACTb) Excise(cut out) codons numbered 5, 6, and 7. Leave the remaining codons. c) Now translate the sequence . d) Explain how many amino acids are now in your polypeptide? e) What would happen to your polypeptide if either of your cysteine amino acids near the start or end of thepolypeptide were translated incorrectly. f) Based on your final polypeptide can you make the original DNA strand by doing reverse translation andtranscription? g) Explain if your polypeptide similar to your template strand or the complementary strand?arrow_forwardConvert the following DNA sequences to RNA sequences.Sequence # 1: CCGGTTCAGGCTTCACCACAGTGTGGAACGCGGTCGTCTCCGGCGACCSequence # 2:CTAAGGTTGCTAATCTCAGCGCTCCGCTGACCCCTCAGCAAAGGGCTTGSequence # 3:GCTCAATCTCGTCCAGCCATTGACCATCGTCGAGGGGTTTGCTCTGTTACSequence # 4:CAAAACGAAATCGAGCGCCATCTGCGGGCCCCGATTACGGACATCAGASequence # 5: TCCAACTCGGGGTCCGCATCGCTCCGCCGGCGACCGACGAAGTTCCGAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY