
Concept explainers
To review:
The decision of the federal government to allocate $79 million (about 40 cents per adult) for a public cord blood collection and storage network is wise or not.
Introduction:
After the birth of the baby, the mother’s body expels the umbilical cord and the placenta from her body, which is then cut out by a health professional. After birth and loss of physical connection with the mother, the baby starts surviving on its own. These discarded portions contain some amount of cord blood (about 50 milliliters), which along with the other blood components is rich in immature stem cells. These stem cells have the capability to divide and produce immature blood cells, which can further form platelets, RBCs (red blood cells), and WBCs (white blood cells).
There are many people who get diagnosed with a type of stem cell cancer that is acute leukemia in the bone marrow. The person diagnosed with this needs to be treated with the help of chemotherapy and radiations for killing the cells of cancer, this is then followed by bone marrow transplantation.

Explanation of Solution
The decision taken by the federal government, who allocated $79 million (about 40 cents per adult) for a public cord blood collection and storage network, is a very good decision. This is because there are many people who are diagnosed with acute leukemia and need to have a bone marrow transplant to get fully cured of this cancer.
Three antigens HLA-B, (human leukocyte antigen-B), HLA-A, and HLA-DR, each having two forms, are involved in a good bone marrow transplantation between the recipient (patient) and the donor. An ideal match for the patient would be having all the same six forms matching to the donor, that is, a 6/6 match. Thus, this seems to be highly difficult and only about 10% of the patients are able to find out their compatible donors.
Due to this reason, the cord blood has become so important because the stem cells in the cord blood are immature, so the transplant of cord blood would lead to fewer transfusion reactions. Transfusion reactions are the ones where the patient's immune system rejects the blood of the donor. Thus, less or even no transfusion reaction would enable a match of 5/6 or 4/6 to be sufficient for transplantation of the bone marrow between the donor and the patient.
Further, keeping all this in mind having a public cord blood collection would be really beneficial as here, people can be able to find their perfect donor from a large pool of cord blood collection. However, if this public cord blood collection is not present, then the patient might have to struggle a lot for a compatible donor or can even end up getting no compatible donor at all.
Therefore, a child born to a healthy family may or may not need its cord blood, but if this child's cord blood is donated into a public cord collection, then anyone going through problems like leukemia can easily access it. Hence, the decision of the federal government for a public cord blood collection was a very good decision.
Want to see more full solutions like this?
Chapter 7 Solutions
Human Biology: Concepts and Current Issues Plus Mastering Biology with Pearson eText -- Access Card Package (8th Edition)
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Understanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:CengageHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
