
Concept explainers
The following is a list of mutational changes. For each of the specific mutations described, indicate which of the terms in the right-hand column applies, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column.
1. an A-T base pair in the wild-type gene is changed to a G-C pair | a. transition |
2. an A-T base pair is changed to a T-A pair | b. base substitution |
3. the sequence AAGCTTATCG is changed to AAGCTATCG | c. transversion |
4. the sequence AAGCTTATCG is changed to AAGCTTTATCG | d. deletion |
5. the sequence AACGTTATCG is changed to AATGTTATCG | e. insertion |
6. the sequence AACGTCACACACATCG is changed to AACGTCACATCG | f. deamination |
g. X-ray irradiation | |
h. intercalator | |

1.
To determine:
The term that describes “an A-T base pair in the wild-type gene is changed to a G-C pair” among the options given below,
a. transition
b. base substitution
c. transversion
d. deletion
e. insertion
f. deamination
g. X-ray irradiation
h. intercalator
Introduction:
When purines and pyrimidines are exchanged with each other, the process is called transition.
Answer to Problem 1P
Correct answer:
An A-T base pair in the wild-type gene is changed to a G-C pair: transition and base substitution.
Explanation of Solution
In the given mutation, A-T base pair is exchanged with a G-C base pair so it can be a base substitution. This can also be a transition mutation because adenine is a purine which is interchanged with another purine that is guanine. Thymine replaced the cytosine, and both are also pyrimidines. Thus, this condition can be a base substitution mutation or a transition mutation.

2.
To determine:
The term that describes “an A-T base pair is changed to a T-A pair” among the options given below,
a. transition
b. base substitution
c. transversion
d. deletion
e. insertion
f. deamination
g. X-ray irradiation
h. intercalator
Introduction:
When one purine is replaced by pyrimidine in a pair of two bases, the resulting process is called transversion.
Answer to Problem 1P
Correct answer:
an A-T base pair is changed to a T-A pair: base substitution and transversion.
Explanation of Solution
In the given mutation, a base pair ‘A-T’ can be changed to a ‘T-A’ base-pair so the replacement of one purine with pyrimidine can be observed. Thus, the mutation for concerting A-T into T-A can be a transversion. The substitution of A by T is taking place so, it can also be a base substitution mutation.

3.
To determine:
The term that describes “the sequence AAGCTTATCG is changed to AAGCTATCG” among the options given below,
a. transition
b. base substitution
c. transversion
d. deletion
e. insertion
f. deamination
g. X-ray irradiation
h. intercalator
Introduction:
In this particular case, the exposure of X-rays is responsible for deletion mutation from the wild type sequence.
Answer to Problem 1P
Correct answer:
the sequence AAGCTTATCG is changed to AAGCTATCG: deletion and X-ray irradiation.
Explanation of Solution
If both, wild type and mutated sequence are observed that it can be seen that there is a deletion of nitrogenous base T from wild type sequence. The exposure to X-ray irradiation may be responsible for deletion mutation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

4.
To determine:
The term that describes “the sequence AAGCTTATCG is changed to AAGCTTTATCG” among the options given below,
a. transition
b. base substitution
c. transversion
d. deletion
e. insertion
f. deamination
g. X-ray irradiation
h. intercalator
Introduction:
When one or more nitrogenous bases are removed from the nucleotide sequence, then the process is called deletion.
Answer to Problem 1P
Correct answer:
the sequence AAGCTTATCG is changed to AAGCTTTATCG: deletion and X-ray irradiation.
Explanation of Solution
Observation of wild type and mutated sequence can lead to a conclusion that there is a deletion of nitrogenous base T from wild type sequence. Deletion mutation may happen to because of exposure to X-ray irradiation. Thus, the correct match for the given mutation is deletion and X-ray irradiation.

5.
To determine:
The term that describes “the sequence AACGTTATCG is changed to AATGTTATCG” among the options given below,
a. transition
b. base substitution
c. transversion
d. deletion
e. insertion
f. deamination
g. X-ray irradiation
h. intercalator
Introduction:
Transition is the change of one purine to another purine or one pyrimidine to another pyrimidine.
Answer to Problem 1P
Correct answer:
the sequence AACGTTATCG is changed to AATGTTATCG: base substitution, transition, and deamination.
Explanation of Solution
In the given mutation, base T is exchanged with base C so it can be a base substitution. This can also be a transition mutation because cytosine is a pyrimidine which is interchanged with another pyrimidine that is thymine. Deamination can also be noticed in the given mutation because the conversion of a methylated C to T is taking place. Thus, the correct match for the given mutation is a substitution, transition, and deamination.

6.
To determine:
The term that describes “the sequence AACGTCACACACATCG is changed to AACGTCACATCG” among the options given below,
a. transition
b. base substitution
c. transversion
d. deletion
e. insertion
f. deamination
g. X-ray irradiation
h. intercalator
Introduction:
Crossing over is the process of exchange of genetic material between the sister chromatids at chiasmata.
Answer to Problem 1P
Correct answer:
The sequence AACGTCACACACATCG is changed to AACGTCACATCG: deletion and crossing over.
Explanation of Solution
In the given mutation, it can be noticed that a segment CACACACA has been lost from wild type sequence, so it is representing deletion. A segment can be removed from the wild type gene during the process of crossing over. Thus, the correct match for the given mutation is deletion and crossing over.
Want to see more full solutions like this?
Chapter 7 Solutions
Genetics: From Genes to Genomes, 5th edition
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning





