ANATOMY AND PHYSIOLOGY ONLINE MATERIALS,
4th Edition
ISBN: 9781265761493
Author: McKinley
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 7, Problem 15DYKB
Summary Introduction
To analyze:
The steps involved in endochondral ossification.
Introduction:
The formation of bone is renowned as osteogenesis or ossification. As the progenitor cells form osteoblastic lines, they undergo 3 major stages of cell differentiation recognized as proliferation, matrix maturation, and mineralization.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 7 Solutions
ANATOMY AND PHYSIOLOGY ONLINE MATERIALS,
Ch. 7.1 - Describe the composition of compact bone and...Ch. 7.1 - In what three locations of the body do you find...Ch. 7.2 - What two minerals are stored in bone, and what are...Ch. 7.2 - What are several examples of flat bones in the...Ch. 7.2 - Prob. 5WDYLCh. 7.2 - Prob. 6WDYLCh. 7.2 - Where is red bone marrow found in the adult...Ch. 7.2 - What are the functions of the osteoprogenitor...Ch. 7.2 - What organic and inorganic substances compose bone...Ch. 7.2 - What are the major components of an osteon?
Ch. 7.2 - What are the primary ways that hyaline cartilage...Ch. 7.3 - Where do interstitial and appositional growth of...Ch. 7.4 - Prob. 13WDYLCh. 7.4 - Briefly describe the process by which a long bone...Ch. 7.5 - Prob. 15WDYLCh. 7.5 - What is bone remodeling, where does it occur, and...Ch. 7.5 - Prob. 17WDYLCh. 7.6 - Prob. 18WDYLCh. 7.6 - Prob. 19WDYLCh. 7.6 - Prob. 20WDYLCh. 7.7 - Prob. 21WDYLCh. 7.8 - Prob. 22WDYLCh. 7 - _____ 1. Which bone is formed from intramembranous...Ch. 7 - Prob. 2DYKBCh. 7 - Prob. 3DYKBCh. 7 - Prob. 4DYKBCh. 7 - Prob. 5DYKBCh. 7 - _____ 6. Which long bone structure is correctly...Ch. 7 - _____ 7. Which statement is correct about an...Ch. 7 - Prob. 8DYKBCh. 7 - Prob. 9DYKBCh. 7 - Prob. 10DYKBCh. 7 - Prob. 11DYKBCh. 7 - Prob. 12DYKBCh. 7 - Prob. 13DYKBCh. 7 - Prob. 14DYKBCh. 7 - Prob. 15DYKBCh. 7 - Prob. 16DYKBCh. 7 - Prob. 17DYKBCh. 7 - Prob. 18DYKBCh. 7 - Prob. 19DYKBCh. 7 - Prob. 20DYKBCh. 7 - Prob. 1CALCh. 7 - Prob. 2CALCh. 7 - Prob. 3CALCh. 7 - To identify the approximate age of skeletal...Ch. 7 - In your anatomy and physiology laboratory, you...Ch. 7 - The traditional surgical procedure to treat...Ch. 7 - A fireman fell from a ladder while fighting a fire...Ch. 7 - Prob. 3CSL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
TISSUE REPAIR Part 1: Repair - Regeneration; Author: ilovepathology;https://www.youtube.com/watch?v=t-5EjlS6qjk;License: Standard YouTube License, CC-BY