
Concept explainers
Introduction:
Hemostasis refers to the cascade of mechanisms that works for stopping the excessive bleeding due to any injury to the blood vessels. This happens by coagulating the blood, that is, converting the liquid form of blood into the gel form. The blood inside our blood vessel is always protected from being coagulated due to the presence of thrombomodulin. It is a substance similar to heparin that prevent the blood coagulation and its aggregation to form clots.
Correct answer:
Steps starting from the damage to the blood vessels and aggregation of platelets to the formation of clot is the whole process of hemostasis.
Justification/ Explanation for the correct answer:
Option (b) is given that the process of hemostasis starts with the injury to some blood vessel that leads to the bleeding and thus, activation of clotting cascade. The platelets group together at that site to form a plug, then the activation of prothrombin occurs and thrombin is formed. Then fibrin is formed from fibrinogen eventually forming a clot at the site of injury to control excessive bleeding. Hence, option (b) is correct.

Want to see the full answer?
Check out a sample textbook solution
Chapter 7 Solutions
Human Biology: Concepts and Current Issues - With Access (Custom)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning


