
Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 10EQ
Summary Introduction
To review:
An experiment must be designed that could show that the recombinant bacterium has been transduced or transformed.
Introduction:
Bacteria can transmit its genetic matter naturally by various mechanisms, one of which is transduction and another one is transformation. Transduction is a technique by which the bacterial genetic material moves one bacterial cell to another via bacteriophages. The transformation is a technique, which takes foreign DNA (deoxyribonucleic acid) from its surrounding environment.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 7 Solutions
Genetics: Analysis and Principles
Ch. 7.1 - 1. A form of genetic transfer that involves the...Ch. 7.2 - 1. A bacterial cell with an F factor conjugates...Ch. 7.2 - 2. Which of the following is a type of plasmid?...Ch. 7.3 - 1. With regard to conjugation, a key difference...Ch. 7.3 - 2. In mapping experiments, ______ strains are...Ch. 7.4 - Prob. 1COMQCh. 7.4 - Cotransduction may be used to map bacterial genes...Ch. 7.5 - Prob. 1COMQCh. 7.5 - Prob. 2COMQCh. 7.6 - 1. Which of the following is an example of...
Ch. 7 - 1. The terms conjugation, transduction, and...Ch. 7 - Prob. 2CONQCh. 7 - If you mix together an equal number of F+ and F...Ch. 7 - What is the difference between an F+ and an Hfr...Ch. 7 - 5. What is the role of the origin of transfer...Ch. 7 - 6. What is the role of sex pili during...Ch. 7 - Prob. 7CONQCh. 7 - Prob. 8CONQCh. 7 - Prob. 9CONQCh. 7 - 10. What is cotransduction? What determines the...Ch. 7 - Prob. 11CONQCh. 7 - Prob. 12CONQCh. 7 - Describe the steps that occur during bacterial...Ch. 7 - Prob. 14CONQCh. 7 - Prob. 15CONQCh. 7 - Antibiotics such as tetracycline, streptomycin,...Ch. 7 - Prob. 1EQCh. 7 - 2. In the experiment of Figure 7.1, Lederberg and...Ch. 7 - Explain how a U-tube apparatus can distinguish...Ch. 7 - Prob. 4EQCh. 7 - 5. In a conjugation experiment, what is meant by...Ch. 7 - In your laboratory, you have an F strain of E....Ch. 7 - 7. As mentioned in question 2 of More Genetic...Ch. 7 - An Hfr strain that is hisE+ and pheA+ was mixed...Ch. 7 - Acridine orange is a chemical that inhibits the...Ch. 7 - Prob. 10EQCh. 7 - Prob. 11EQCh. 7 - Lets suppose a new strain of P1 phage has been...Ch. 7 - If two bacterial genes are 0.6 minute apart on the...Ch. 7 - 14. In a cotransduction experiment involving P1,...Ch. 7 - Prob. 15EQCh. 7 - Prob. 16EQCh. 7 - 1. Discuss the advantages of the genetic analysis...Ch. 7 - Prob. 2QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning


Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
genetic recombination strategies of bacteria CONJUGATION, TRANSDUCTION AND TRANSFORMATION; Author: Scientist Cindy;https://www.youtube.com/watch?v=_Va8FZJEl9A;License: Standard youtube license