Foundations in Microbiology
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
Question
Book Icon
Chapter 6.7, Problem 27CYP
Summary Introduction

To analyse:

The advantages and disadvantages of using cell culture for cultivating virus.

Introduction:

Regulated growth and cultivation of viruses is necessary for performing tests and research on them. Since viruses cannot grow in the absence of host cells, they are cultivated in special conditions. These are either in vitro methods using cell or tissue cultures, or in vivo methods involving inoculation of laboratory-bred animals and embryonic bird tissues.

Blurred answer
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?

Chapter 6 Solutions

Foundations in Microbiology

Ch. 6.2 - Prob. 7ELOCh. 6.2 - Summarize the different viral groups based on...Ch. 6.3 - Prob. 9ELOCh. 6.3 - Indicate the characteristics used in identifying...Ch. 6.3 - Prob. 5CYPCh. 6.3 - Describe the general structure of viruses.Ch. 6.3 - Prob. 7CYPCh. 6.3 - Prob. 8CYPCh. 6.3 - Prob. 9CYPCh. 6.3 - Prob. 10CYPCh. 6.3 - How are the poxviruses different from other animal...Ch. 6.3 - Prob. 12CYPCh. 6.3 - How are generic and common names used?Ch. 6.4 - Describe the virus-host relationship.Ch. 6.4 - Prob. 12ELOCh. 6.4 - Prob. 13ELOCh. 6.4 - Prob. 14ELOCh. 6.4 - Explain two ways in which animal viruses are...Ch. 6.4 - Prob. 16ELOCh. 6.4 - Write a narrative that describes the stages in the...Ch. 6.4 - Prob. 15CYPCh. 6.4 - Summarise the two major ways in which animal...Ch. 6.4 - Prob. 17CYPCh. 6.4 - Describe several cytopathic effects of viruses....Ch. 6.4 - Explain what it means for a virus to become...Ch. 6.4 - Prob. 20CYPCh. 6.5 - Prob. 17ELOCh. 6.5 - Explain what is meant by lysogeny, prophage,...Ch. 6.5 - Prob. 19ELOCh. 6.5 - In simple terms, what does the viral nucleic acid...Ch. 6.5 - What processes are involved in bacteriophage...Ch. 6.5 - Prob. 23CYPCh. 6.5 - Compare and contrast the main phases in the lytic...Ch. 6.5 - why is penetration so different between the two...Ch. 6.6 - Prob. 20ELOCh. 6.6 - Compare the methods and uses of cell culture, bird...Ch. 6.7 - Prob. 22ELOCh. 6.7 - Prob. 23ELOCh. 6.7 - Describe the three main techniques for cultivating...Ch. 6.7 - Prob. 27CYPCh. 6.7 - What are cell lines and monolayers, and how are...Ch. 6.7 - Prob. 29CYPCh. 6.8 - Prob. 24ELOCh. 6.8 - Prob. 25ELOCh. 6.8 - Prob. 30CYPCh. 6.8 - Prob. 31CYPCh. 6.L1 - Prob. 1MCQCh. 6.L1 - Prob. 2MCQCh. 6.L1 - The capsid is composed of protein subunits called...Ch. 6.L1 - Prob. 4MCQCh. 6.L1 - Prob. 5MCQCh. 6.L1 - Prob. 6MCQCh. 6.L1 - A prophage is a/an ____ stage in the cycle of...Ch. 6.L1 - Prob. 8MCQCh. 6.L1 - Prob. 9MCQCh. 6.L1 - Prob. 10MCQCh. 6.L1 - Prob. 11MCQCh. 6.L1 - Prob. 12MCQCh. 6.L1 - Prob. 13MCQCh. 6.L1 - Prob. 14MCQCh. 6.L1 - Prob. 15MCQCh. 6.L1 - Prob. 1CSRCh. 6.L1 - Prob. 2CSRCh. 6.L1 - Prob. 3CSRCh. 6.L1 - a. What characteristics of viruses could be used...Ch. 6.L1 - Prob. 2WCCh. 6.L1 - a. Since viruses lack metabolic enzymes, how can...Ch. 6.L1 - Prob. 4WCCh. 6.L2 - Prob. 1CTCh. 6.L2 - Prob. 2CTCh. 6.L2 - Prob. 3CTCh. 6.L2 - a. Given that DNA viruses can be carried in the...Ch. 6.L2 - Prob. 5CTCh. 6.L2 - Is there such a thing as a “good virus�?...Ch. 6.L2 - Prob. 7CTCh. 6.L2 - Prob. 8CTCh. 6.L2 - Prob. 9CTCh. 6.L2 - Label the parts of viruses in figures...Ch. 6.L2 - How would you describe the kind of capsid found on...
Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Aquaculture Science
Biology
ISBN:9781133558347
Author:Parker
Publisher:Cengage
Text book image
Science Of Agriculture Biological Approach
Biology
ISBN:9780357229323
Author:Herren
Publisher:Cengage
Text book image
Basic Clinical Laboratory Techniques 6E
Biology
ISBN:9781133893943
Author:ESTRIDGE
Publisher:Cengage
Text book image
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Text book image
Biomedical Instrumentation Systems
Chemistry
ISBN:9781133478294
Author:Chatterjee
Publisher:Cengage
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning