
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 6.7, Problem 27CYP
Summary Introduction
To analyse:
The advantages and disadvantages of using cell culture for cultivating virus.
Introduction:
Regulated growth and cultivation of viruses is necessary for performing tests and research on them. Since viruses cannot grow in the absence of host cells, they are cultivated in special conditions. These are either in vitro methods using cell or tissue cultures, or in vivo methods involving inoculation of laboratory-bred animals and embryonic bird tissues.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 6 Solutions
Foundations in Microbiology
Ch. 6.1 - Indicate how viruses were discovered and...Ch. 6.1 - Describe the unique characteristics of viruses.Ch. 6.1 - Discuss the origin and importance of viruses.Ch. 6.1 - Prob. 1CYPCh. 6.1 - Prob. 2CYPCh. 6.1 - Explain what it means to be an obligate...Ch. 6.1 - Prob. 4CYPCh. 6.2 - Prob. 4ELOCh. 6.2 - Distinguish among types of capsids and...Ch. 6.2 - Prob. 6ELO
Ch. 6.2 - Prob. 7ELOCh. 6.2 - Summarize the different viral groups based on...Ch. 6.3 - Prob. 9ELOCh. 6.3 - Indicate the characteristics used in identifying...Ch. 6.3 - Prob. 5CYPCh. 6.3 - Describe the general structure of viruses.Ch. 6.3 - Prob. 7CYPCh. 6.3 - Prob. 8CYPCh. 6.3 - Prob. 9CYPCh. 6.3 - Prob. 10CYPCh. 6.3 - How are the poxviruses different from other animal...Ch. 6.3 - Prob. 12CYPCh. 6.3 - How are generic and common names used?Ch. 6.4 - Describe the virus-host relationship.Ch. 6.4 - Prob. 12ELOCh. 6.4 - Prob. 13ELOCh. 6.4 - Prob. 14ELOCh. 6.4 - Explain two ways in which animal viruses are...Ch. 6.4 - Prob. 16ELOCh. 6.4 - Write a narrative that describes the stages in the...Ch. 6.4 - Prob. 15CYPCh. 6.4 - Summarise the two major ways in which animal...Ch. 6.4 - Prob. 17CYPCh. 6.4 - Describe several cytopathic effects of viruses....Ch. 6.4 - Explain what it means for a virus to become...Ch. 6.4 - Prob. 20CYPCh. 6.5 - Prob. 17ELOCh. 6.5 - Explain what is meant by lysogeny, prophage,...Ch. 6.5 - Prob. 19ELOCh. 6.5 - In simple terms, what does the viral nucleic acid...Ch. 6.5 - What processes are involved in bacteriophage...Ch. 6.5 - Prob. 23CYPCh. 6.5 - Compare and contrast the main phases in the lytic...Ch. 6.5 - why is penetration so different between the two...Ch. 6.6 - Prob. 20ELOCh. 6.6 - Compare the methods and uses of cell culture, bird...Ch. 6.7 - Prob. 22ELOCh. 6.7 - Prob. 23ELOCh. 6.7 - Describe the three main techniques for cultivating...Ch. 6.7 - Prob. 27CYPCh. 6.7 - What are cell lines and monolayers, and how are...Ch. 6.7 - Prob. 29CYPCh. 6.8 - Prob. 24ELOCh. 6.8 - Prob. 25ELOCh. 6.8 - Prob. 30CYPCh. 6.8 - Prob. 31CYPCh. 6.L1 - Prob. 1MCQCh. 6.L1 - Prob. 2MCQCh. 6.L1 - The capsid is composed of protein subunits called...Ch. 6.L1 - Prob. 4MCQCh. 6.L1 - Prob. 5MCQCh. 6.L1 - Prob. 6MCQCh. 6.L1 - A prophage is a/an ____ stage in the cycle of...Ch. 6.L1 - Prob. 8MCQCh. 6.L1 - Prob. 9MCQCh. 6.L1 - Prob. 10MCQCh. 6.L1 - Prob. 11MCQCh. 6.L1 - Prob. 12MCQCh. 6.L1 - Prob. 13MCQCh. 6.L1 - Prob. 14MCQCh. 6.L1 - Prob. 15MCQCh. 6.L1 - Prob. 1CSRCh. 6.L1 - Prob. 2CSRCh. 6.L1 - Prob. 3CSRCh. 6.L1 - a. What characteristics of viruses could be used...Ch. 6.L1 - Prob. 2WCCh. 6.L1 - a. Since viruses lack metabolic enzymes, how can...Ch. 6.L1 - Prob. 4WCCh. 6.L2 - Prob. 1CTCh. 6.L2 - Prob. 2CTCh. 6.L2 - Prob. 3CTCh. 6.L2 - a. Given that DNA viruses can be carried in the...Ch. 6.L2 - Prob. 5CTCh. 6.L2 - Is there such a thing as a “good virus�?...Ch. 6.L2 - Prob. 7CTCh. 6.L2 - Prob. 8CTCh. 6.L2 - Prob. 9CTCh. 6.L2 - Label the parts of viruses in figures...Ch. 6.L2 - How would you describe the kind of capsid found on...
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning