Foundations in Microbiology
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 6.L1, Problem 4MCQ
Summary Introduction

Introduction:

Viruses comprise of a nucleic acids core covered by a layer of capsid. Capsid layer is proteinaceous in nature and serves to protect the nucleic acids. In addition, some virus also possess a membranous layer called envelope.

Blurred answer
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?

Chapter 6 Solutions

Foundations in Microbiology

Ch. 6.2 - Prob. 7ELOCh. 6.2 - Summarize the different viral groups based on...Ch. 6.3 - Prob. 9ELOCh. 6.3 - Indicate the characteristics used in identifying...Ch. 6.3 - Prob. 5CYPCh. 6.3 - Describe the general structure of viruses.Ch. 6.3 - Prob. 7CYPCh. 6.3 - Prob. 8CYPCh. 6.3 - Prob. 9CYPCh. 6.3 - Prob. 10CYPCh. 6.3 - How are the poxviruses different from other animal...Ch. 6.3 - Prob. 12CYPCh. 6.3 - How are generic and common names used?Ch. 6.4 - Describe the virus-host relationship.Ch. 6.4 - Prob. 12ELOCh. 6.4 - Prob. 13ELOCh. 6.4 - Prob. 14ELOCh. 6.4 - Explain two ways in which animal viruses are...Ch. 6.4 - Prob. 16ELOCh. 6.4 - Write a narrative that describes the stages in the...Ch. 6.4 - Prob. 15CYPCh. 6.4 - Summarise the two major ways in which animal...Ch. 6.4 - Prob. 17CYPCh. 6.4 - Describe several cytopathic effects of viruses....Ch. 6.4 - Explain what it means for a virus to become...Ch. 6.4 - Prob. 20CYPCh. 6.5 - Prob. 17ELOCh. 6.5 - Explain what is meant by lysogeny, prophage,...Ch. 6.5 - Prob. 19ELOCh. 6.5 - In simple terms, what does the viral nucleic acid...Ch. 6.5 - What processes are involved in bacteriophage...Ch. 6.5 - Prob. 23CYPCh. 6.5 - Compare and contrast the main phases in the lytic...Ch. 6.5 - why is penetration so different between the two...Ch. 6.6 - Prob. 20ELOCh. 6.6 - Compare the methods and uses of cell culture, bird...Ch. 6.7 - Prob. 22ELOCh. 6.7 - Prob. 23ELOCh. 6.7 - Describe the three main techniques for cultivating...Ch. 6.7 - Prob. 27CYPCh. 6.7 - What are cell lines and monolayers, and how are...Ch. 6.7 - Prob. 29CYPCh. 6.8 - Prob. 24ELOCh. 6.8 - Prob. 25ELOCh. 6.8 - Prob. 30CYPCh. 6.8 - Prob. 31CYPCh. 6.L1 - Prob. 1MCQCh. 6.L1 - Prob. 2MCQCh. 6.L1 - The capsid is composed of protein subunits called...Ch. 6.L1 - Prob. 4MCQCh. 6.L1 - Prob. 5MCQCh. 6.L1 - Prob. 6MCQCh. 6.L1 - A prophage is a/an ____ stage in the cycle of...Ch. 6.L1 - Prob. 8MCQCh. 6.L1 - Prob. 9MCQCh. 6.L1 - Prob. 10MCQCh. 6.L1 - Prob. 11MCQCh. 6.L1 - Prob. 12MCQCh. 6.L1 - Prob. 13MCQCh. 6.L1 - Prob. 14MCQCh. 6.L1 - Prob. 15MCQCh. 6.L1 - Prob. 1CSRCh. 6.L1 - Prob. 2CSRCh. 6.L1 - Prob. 3CSRCh. 6.L1 - a. What characteristics of viruses could be used...Ch. 6.L1 - Prob. 2WCCh. 6.L1 - a. Since viruses lack metabolic enzymes, how can...Ch. 6.L1 - Prob. 4WCCh. 6.L2 - Prob. 1CTCh. 6.L2 - Prob. 2CTCh. 6.L2 - Prob. 3CTCh. 6.L2 - a. Given that DNA viruses can be carried in the...Ch. 6.L2 - Prob. 5CTCh. 6.L2 - Is there such a thing as a “good virus�?...Ch. 6.L2 - Prob. 7CTCh. 6.L2 - Prob. 8CTCh. 6.L2 - Prob. 9CTCh. 6.L2 - Label the parts of viruses in figures...Ch. 6.L2 - How would you describe the kind of capsid found on...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Text book image
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Text book image
Body Structures & Functions
Biology
ISBN:9781285695495
Author:Scott
Publisher:Cengage
Text book image
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Text book image
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Biology
ISBN:9781305967359
Author:STARR
Publisher:CENGAGE L
Text book image
Body Structures & Functions Updated
Biology
ISBN:9780357191606
Author:Scott
Publisher:Cengage
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY