
Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 6.2, Problem 2COMQ
Summary Introduction
Introduction:
Thomas Hunt Morgan worked on Drosophila melanogaster (fruit fly) and was responsible for giving a concrete proof that genes are physically located close to each other and inherited as a complete unit. His work on sex-linked inheritance is an important part of genetics.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 6 Solutions
Genetics: Analysis and Principles
Ch. 6.1 - 1. Genetic linkage occurs because
a. genes that...Ch. 6.1 - In the experiment by Bateson and Punnett, which of...Ch. 6.2 - Prob. 1COMQCh. 6.2 - Prob. 2COMQCh. 6.2 - 3. For a chi square analysis involving genes that...Ch. 6.3 - Answer the multiple-choice questions based on the...Ch. 6.3 - Answer the multiple-choice questions based on the...Ch. 6.4 - 1. A tetrad of spores in an ascus is the product...Ch. 6.4 - Prob. 2COMQCh. 6.5 - 1. The process of mitotic recombination involves...
Ch. 6 - 1. What is the difference in meaning between the...Ch. 6 - 2. When a chi square analysis is applied to solve...Ch. 6 - 3. What is mitotic recombination? A heterozygous...Ch. 6 - 4. Mitotic recombination can occasionally produce...Ch. 6 - 5. A crossover has occurred in the bivalent shown...Ch. 6 - A crossover has occurred in the bivalent shown...Ch. 6 - A diploid organism has a total of 14 chromosomes...Ch. 6 - If you try to throw a basketball into a basket,...Ch. 6 - 9. By conducting testcrosses, researchers have...Ch. 6 - In humans, a rare dominant disorder known as...Ch. 6 - 11. When true-breeding mice with brown fur and...Ch. 6 - Though we often think of genes in terms of the...Ch. 6 - 13. If the likelihood of a single crossover in a...Ch. 6 - 14. In most two-factor crosses involving linked...Ch. 6 - Researchers have discovered that some regions of...Ch. 6 - 16. Describe the unique features of ascomycetes...Ch. 6 - Figure 6.1 shows the first experimental results...Ch. 6 - In the experiment of Figure 6.6, Stern followed...Ch. 6 - 3. Explain the rationale behind a testcross. Is it...Ch. 6 - 4. In your own words, explain why a testcross...Ch. 6 - Explain why the percentage of recombinant...Ch. 6 - 6. If two genes are more thanapart, how would you...Ch. 6 - 7. In Morgan’s three-factor crosses of Figure 6.3,...Ch. 6 - Two genes are located on the same chromosome and...Ch. 6 - 9. Two genes, designated A and B, are locatedfrom...Ch. 6 - 10. Two genes in tomatoes areapart; normal fruit...Ch. 6 - In the tomato, three genes are linked on the same...Ch. 6 - A trait in garden peas involves the curling of...Ch. 6 - Prob. 13EQCh. 6 - 14. In the garden pea, several different genes...Ch. 6 - A sex-influenced trait is dominant in males and...Ch. 6 - Three recessive traits in garden pea plants are as...Ch. 6 - In mice, a trait called snubnose is recessive to a...Ch. 6 - 18. In Drosophila, an allele causing vestigial...Ch. 6 - 19. Three autosomal genes are linked along the...Ch. 6 - 20. Let’s suppose that two different X-linked...Ch. 6 - Prob. 21EQCh. 6 - In mice, a dominant allele that causes a short...Ch. 6 - 2. In Chapter 3, we discussed the idea that the X...Ch. 6 - Mendel studied seven traits in pea plants, and the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning


Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
How to solve genetics probability problems; Author: Shomu's Biology;https://www.youtube.com/watch?v=R0yjfb1ooUs;License: Standard YouTube License, CC-BY
Beyond Mendelian Genetics: Complex Patterns of Inheritance; Author: Professor Dave Explains;https://www.youtube.com/watch?v=-EmvmBuK-B8;License: Standard YouTube License, CC-BY