BIOLOGY
5th Edition
ISBN: 9781265202859
Author: BROOKER
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 6.2, Problem 1CS
Summary Introduction
To determine: The way in which process of translation would be affected if RNase P does not perform a proper function with reference to the figure 12-20 given in text book.
Introduction: Ribonuclease P is a catalyst that is involved in the processing of transfer RNA (Ribose
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Pls Provide what is being asked in the picture given
Learning Task 3: TRACE THE CODE
dentify the amino acids coded for by the MRNA codon using the Genetic Code
Table below.
Order of bases
in mRNA
(codon)
AUC
Order or bases
Order of bases Amino acid Coded
in DNA
in tRNA
into Proteins
TAG
CAT
GC
СА
UAC
Methionine
Valine
Procedures:
Copy and fill in the table
Refer to the Genetic Code table to identify the amino acid.
To determine the order of bases in the first column (DNA), second column
1.
2.
3.
(codon) and third column (anticodon), consider the complementary base pairs in
DNA adenine pairs with thymine and guanine pairs with cytosine.
4
Example, AUG using the Genetic Code Table. Look for the first letter of the MRNA
codon on the left side of the genetic code table (A). The second letter of the MRNA
on the second letter column (U) and the third letter on the right-side column (G).
AUG codes for the amino acid methionine.
To identify the amino acid. Look at the bases in the MRNA codon.
5.
Do the same with the other codons in the chart.…
Exercise
In this exercise we will practice transcribing and translating sample DNA. Using your sample DNA,
unzipped and second strand removed, you will first create an RNA strand (transcription). DNA is read in
the 5' → 3' direction, so when you create RNA, a 3'end pairs with the 5' end of DNA. From your RNA
strand, you will need to create codons; remember that a codon is a group of 3 bases that codes for a
specific amino acid. Your codons are read in the 5' → 3' direction (hint: it might be right to left!). You
will then need to convert your codons into amino acids in the 5' → 3' direction (translation).
DNA strand
3' TAC-TTA-CGA-TGG-TAC-ACG-CAA-TCT-ATA-CTC-AAA-TAT-AGG-ACC-TTG-ACG-TCG-AAT-CTC-CAC-TGT-ACC-TTG-AAC-CTG-ACT 5'
RNA strand
5'-AUG-AAU
Amino acid sequence
G
ne
(9)
Chapter 6 Solutions
BIOLOGY
Ch. 6.1 - Which do you think has more entropy, a NaCl...Ch. 6.1 - Prob. 2CCCh. 6.2 - Prob. 1CCCh. 6.2 - Prob. 2CCCh. 6.2 - Prob. 1CSCh. 6.2 - Prob. 1EQCh. 6.2 - Prob. 2EQCh. 6.2 - Prob. 3EQCh. 6.3 - Prob. 1CSCh. 6.3 - Prob. 2CS
Ch. 6.4 - What are advantages of protein degradation?Ch. 6 - Reactions that release free energy are a....Ch. 6 - Enzymes speed up reactions by a. providing...Ch. 6 - Prob. 3TYCh. 6 - Researchers analyzed a cell extracta mixture of...Ch. 6 - In biological systems, ATP functions by a....Ch. 6 - In a chemical reaction, NADH is converted to NAD+...Ch. 6 - Prob. 7TYCh. 6 - Prob. 8TYCh. 6 - Prob. 9TYCh. 6 - Autophagy provides a way for cells to a. degrade...Ch. 6 - Prob. 1CQCh. 6 - Prob. 2CQCh. 6 - Prob. 3CQCh. 6 - Prob. 1COQCh. 6 - Prob. 2COQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- O Macmillan Learning Translate the mRNA, starting at the first 5' nucleotide, assuming that translation occurs in an E. coli cell. (5') AUGGGUCGUGAGUCAUCGUUAAUUGUAGCUGGAGGGGAGGAAUGA (3') Enter the sequence using the one-letter amino acid codes. amino acid sequence: Incorrect Answer MGRERSLIAVAGGRarrow_forwardSolve all parts otherwise I will downvotearrow_forwardMacmillan Learning Label the structural features of the yeast phenylalanine tRNA. Answer Bank region that carries the amino acid at its end Extra arm 5' end region that contains the bases ribothymidine and pseudouridine region that contains the base dihydrouridine region that contains the anticodon, which base pairs with the mRNAarrow_forward
- Pls help ASAParrow_forwardINSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Amino acyl tRNA synthase is the enzyme responsible for joining amino acid together STAMENT 2: Nucleus is the part of the cell where translation takes place ANSWER: STAMENT 1: DNA sequences where RNA polymerase binds initially is called promoter sequences STAMENT 2: UV light causes adenine to dimerize ANSWER: STAMENT 1: Guanosine is the name of the compound formed when guanine is bonded to ribose STAMENT 2: DNA pairing is the term that refers to the process when two complementary and single stranded DNA combine ANSWER:arrow_forwardInstructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.arrow_forward
- please help with thisarrow_forwardPlease asaparrow_forwardINSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: Heterogenous RNA is a term that refers to mRNA that has not been processed STAMENT 2: If the %A of a bacteria is 20%, the amount of guanine is 30% STAMENT 1: A frameshift mutation involves a change in the reading frame used in the translation of an mRNA STAMENT 2: The genetic code is specific because each codon specifies only for one amino acid STAMENT 1: Binding of RNA primer to the DNA is the first step in the transcription cycle STAMENT 2: Translation refers to the synthesis of proteins using the information contained in mRNAarrow_forward
- 1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme. Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes in every cell.arrow_forwardExercise 1 The order of a molecule of mRNA is given like following. AAAUGUCAAACGAGGCCGAUCAUUAAACU a- Determine the corresponding non-transcribed strand of DNA based on the above RNA molecule. C b- Name the phenomenon shown in the figures. c- What is the codon of start ? d- Arrange the stages given in the chronological order.arrow_forwardpls help me to complete these problemarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license