
Concept explainers
Which type of cartilage is most plentiful in the adult body?

To review:
The type of cartilage, which is found in the abundance in the body of an adult.
Introduction:
Skeletal cartilage is basically composed of some different cartilage tissue that are manufactured in order to fit its body function and location. Cartilage is known mainly comprise water that reckons for the resilience. Resilience is basically the capability to spring back to the normal shape after being compressed. Cartilages are of three types, namely, fibro, elastic, and hyaline cartilage.
Explanation of Solution
Chondrocytes are the cells that form the basic component of all the cartilages. These are present in an extracellular matrix that contains fibers and a jelly-like ground substance and is encased in lacunae (small cavities). The three types of cartilages are:
1. Fibrocartilages: They have the great tensile strength and are highly compressible. They contain chondrocytes arranged roughly parallel to each other. These chondrocytes alternate with collagen fibers.
2. Hyaline cartilages: They are the skeletal cartilages found in abundance. They are resilient and flexible, providing support. They contain spherical chondrocytes and fine collagen fibers in their matrix.
3. Elastic cartilages: They are somewhat like hyaline cartilages. However, they have elastic fibers that can stretch more and can bend repeatedly.
Therefore, it can be concluded that hyaline cartilage is most plentiful in the body of an adult.
Want to see more full solutions like this?
Chapter 6 Solutions
Anatomy & Physiology
Additional Science Textbook Solutions
Introductory Chemistry (6th Edition)
Microbiology with Diseases by Body System (5th Edition)
Applications and Investigations in Earth Science (9th Edition)
Human Physiology: An Integrated Approach (8th Edition)
Organic Chemistry (8th Edition)
Campbell Biology (11th Edition)
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax




