Anatomy & Physiology
Anatomy & Physiology
5th Edition
ISBN: 9780321861580
Author: Marieb, Elaine N.
Publisher: Pearson College Div
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 6, Problem 1CYU

Which type of cartilage is most plentiful in the adult body?

Expert Solution & Answer
Check Mark
Summary Introduction

To review:

The type of cartilage, which is found in the abundance in the body of an adult.

Introduction:

Skeletal cartilage is basically composed of some different cartilage tissue that are manufactured in order to fit its body function and location. Cartilage is known mainly comprise water that reckons for the resilience. Resilience is basically the capability to spring back to the normal shape after being compressed. Cartilages are of three types, namely, fibro, elastic, and hyaline cartilage.

Explanation of Solution

Chondrocytes are the cells that form the basic component of all the cartilages. These are present in an extracellular matrix that contains fibers and a jelly-like ground substance and is encased in lacunae (small cavities). The three types of cartilages are:

1. Fibrocartilages: They have the great tensile strength and are highly compressible. They contain chondrocytes arranged roughly parallel to each other. These chondrocytes alternate with collagen fibers.

2. Hyaline cartilages: They are the skeletal cartilages found in abundance. They are resilient and flexible, providing support. They contain spherical chondrocytes and fine collagen fibers in their matrix.

3. Elastic cartilages: They are somewhat like hyaline cartilages. However, they have elastic fibers that can stretch more and can bend repeatedly.

Conclusion

Therefore, it can be concluded that hyaline cartilage is most plentiful in the body of an adult.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
03:07
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?

Chapter 6 Solutions

Anatomy & Physiology

Ch. 6 - How does the structure of compact bone differ from...Ch. 6 - Which membrane lines the internal canals and...Ch. 6 - Which component of bone-organic or inorganic-makes...Ch. 6 - Prob. 14CYUCh. 6 - Bones dont begin with bone tissue. What do they...Ch. 6 - When describing endochondral ossification, some...Ch. 6 - Where is the primary ossification center located...Ch. 6 - As a long bone grows in length, what is happening...Ch. 6 - If osteoclasts in a long bone are more active than...Ch. 6 - Which stimulus-PTH (a hormone) or mechanical...Ch. 6 - How does an open fracture differ from a closed...Ch. 6 - How do bone growth and bone remodeling differ?Ch. 6 - Which bone disorder is characterized by excessive...Ch. 6 - What are three measures that may help to maintain...Ch. 6 - Prob. 25CYUCh. 6 - Which is a function of the skeletal system? (a)...Ch. 6 - A bone with approximately the same width, length,...Ch. 6 - The shaft of a long bone is properly called the...Ch. 6 - Sites of hematopoiesis include all but (a) red...Ch. 6 - An osteon has (a) a central canal carrying blood...Ch. 6 - Prob. 6RQCh. 6 - The flat bones of the skull develop from (a)...Ch. 6 - The remodeling of bone is a function of which...Ch. 6 - Bone remodeling in adults is regulated and...Ch. 6 - Prob. 10RQCh. 6 - Wolffs law is concerned with (a) calcium...Ch. 6 - Prob. 12RQCh. 6 - Prob. 13RQCh. 6 - Prob. 14RQCh. 6 - Compare bone to cartilage tissue relative to its...Ch. 6 - Describe in proper sequence the events of...Ch. 6 - Osteocytes residing in lacunae of osteons of...Ch. 6 - As we grow, our long bones increase in diameter,...Ch. 6 - Describe the process of new bone formation in an...Ch. 6 - Compare and contrast controls of bone remodeling...Ch. 6 - Yolanda is asked to review a bone slide that her...Ch. 6 - Remember Mrs. DeStephano? When we last heard about...Ch. 6 - Remember Mrs. DeStephano? When we last heard about...Ch. 6 - Remember Mrs. DeStephano? When we last heard about...Ch. 6 - Remember Mrs. DeStephano? When we last heard about...Ch. 6 - Remember Mrs. DeStephano? When we last heard about...Ch. 6 - Remember Mrs. DeStephano? When we last heard about...Ch. 6 - Remember Mrs. DeStephano? When we last heard about...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
  • Text book image
    Principles Of Radiographic Imaging: An Art And A ...
    Health & Nutrition
    ISBN:9781337711067
    Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
    Publisher:Cengage Learning
    Text book image
    Human Biology (MindTap Course List)
    Biology
    ISBN:9781305112100
    Author:Cecie Starr, Beverly McMillan
    Publisher:Cengage Learning
    Text book image
    Body Structures & Functions
    Biology
    ISBN:9781285695495
    Author:Scott
    Publisher:Cengage
  • Text book image
    Concepts of Biology
    Biology
    ISBN:9781938168116
    Author:Samantha Fowler, Rebecca Roush, James Wise
    Publisher:OpenStax College
    Text book image
    Anatomy & Physiology
    Biology
    ISBN:9781938168130
    Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
    Publisher:OpenStax College
    Text book image
    Biology 2e
    Biology
    ISBN:9781947172517
    Author:Matthew Douglas, Jung Choi, Mary Ann Clark
    Publisher:OpenStax
Text book image
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Text book image
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Text book image
Body Structures & Functions
Biology
ISBN:9781285695495
Author:Scott
Publisher:Cengage
Text book image
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Text book image
Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Types of Human Body Tissue; Author: MooMooMath and Science;https://www.youtube.com/watch?v=O0ZvbPak4ck;License: Standard YouTube License, CC-BY