CONNECT WITH LEARNSMART FOR COWAN: MICR
3rd Edition
ISBN: 2818440123740
Author: Cowan
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 6, Problem 18Q
Summary Introduction
To describe:
A scenario in which having long generation time would be advantageous to a pathogen.
Concept introduction:
Germination time also known as doubling time is the time taken by the bacteria to increase the population by a factor of "2" in number during a specified time period. The generation time is different for different organisms. For example the germination time is 20 minutes for E,coli and 30 minutes for S.aurieus.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
Chapter 6 Solutions
CONNECT WITH LEARNSMART FOR COWAN: MICR
Ch. 6.1 - List the essential nutrients of a bacterial cell.Ch. 6.1 - Prob. 2AYPCh. 6.1 - List and define four different terms that describe...Ch. 6.1 - Prob. 4AYPCh. 6.1 - Compare and contrast the processes of diffusion...Ch. 6.1 - Identify the effects of isotonic, hypotonic, and...Ch. 6.1 - Name two types of passive transport and one type...Ch. 6.1 - Prob. 1NPCh. 6.1 - Prob. 2NPCh. 6.1 - Prob. 3NP
Ch. 6.1 - Prob. 1MMCh. 6.2 - List and define five terms used to express the...Ch. 6.2 - Summarize three ways in which microorganisms...Ch. 6.2 - Identify three important environmental factors...Ch. 6.2 - List and describe the five types of associations...Ch. 6.2 - Discuss characteristics of biofilms that...Ch. 6.2 - Which statements are true with respect to...Ch. 6.3 - Summarize the steps of cell division used by most...Ch. 6.3 - Define doubling time, and describe how it leads to...Ch. 6.3 - Compare and contrast the four phases of growth in...Ch. 6.3 - Identify one culture-based and one...Ch. 6.3 - Prob. 2MMCh. 6 - Which descriptors are likely to have applied to...Ch. 6 - Prob. 2QCh. 6 - Speculate about how earths atmosphere came to...Ch. 6 - Which of the following is true of passive...Ch. 6 - Compare the effects of a hypertonic, hypotonic,...Ch. 6 - Usually scientists looking for life on other...Ch. 6 - An organism that can synthesize all its required...Ch. 6 - Provide evidence in support of or refuting this...Ch. 6 - Develop an explanation for why biofilm bacteria...Ch. 6 - Most bacteria increase their numbers by a. sexual...Ch. 6 - Looking at figure 6.3, explain how a cell in a...Ch. 6 - In binary fission, the parent chromosome is...Ch. 6 - A cell exposed to a hypertonic environment will...Ch. 6 - Prob. 14QCh. 6 - Bacteria and archaea are ubiquitous on the planet....Ch. 6 - Prob. 16QCh. 6 - How can you explain the fact that an unopened...Ch. 6 - Prob. 18QCh. 6 - In a viable count, each ____ represents a ______...Ch. 6 - If an egg salad sandwich sitting in a car on a...Ch. 6 - Scientists now believe that most bacteria in...Ch. 6 - Prob. 1VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
- Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage