BIOLOGY (LOOSELEAF)-W/CONNECT
12th Edition
ISBN: 9781260692181
Author: Raven
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 56, Problem 5IQ
Summary Introduction
To determine: The way in which the biomass of primary producers stays constant as the primary productivity increases.
Introduction: Primary producers are the species that prepare their food and energy by using sunlight. These organisms produce organic compounds by breaking down the inorganic compound.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Chapter 56 Solutions
BIOLOGY (LOOSELEAF)-W/CONNECT
Ch. 56.1 - Prob. 1LOCh. 56.1 - Prob. 2LOCh. 56.1 - Prob. 3LOCh. 56.2 - Describe the different trophic levels.Ch. 56.2 - Distinguish between energy and heat.Ch. 56.2 - Explain how energy moves through trophic levels.Ch. 56.3 - Explain the meaning of trophic cascade.Ch. 56.3 - Prob. 2LOCh. 56.4 - Define ecosystem stability.Ch. 56.4 - Prob. 2LO
Ch. 56.4 - Prob. 3LOCh. 56.5 - Prob. 1LOCh. 56.5 - Prob. 2LOCh. 56 - Prob. 1DACh. 56 - Prob. 2DACh. 56 - Prob. 3DACh. 56 - Prob. 4DACh. 56 - Prob. 1IQCh. 56 - Prob. 2IQCh. 56 - Prob. 3IQCh. 56 - Prob. 4IQCh. 56 - Prob. 5IQCh. 56 - Prob. 6IQCh. 56 - Prob. 7IQCh. 56 - Which of the statements about groundwater is NOT...Ch. 56 - Photosynthetic organisms a. fix carbon dioxide. b....Ch. 56 - Prob. 3UCh. 56 - Nitrogen is often a limiting nutrient in many...Ch. 56 - Prob. 5UCh. 56 - Prob. 6UCh. 56 - Inverted ecological pyramids of real systems...Ch. 56 - Prob. 8UCh. 56 - Prob. 9UCh. 56 - The equilibrium model of island biogeography...Ch. 56 - Based on results from studies at Hubbard Brook...Ch. 56 - According to the trophic cascade hypothesis, the...Ch. 56 - At Cedar Creek Natural History Area, experimental...Ch. 56 - Given that ectotherms do not utilize a large...Ch. 56 - Given that, in general, energy input is greatest...Ch. 56 - Prob. 3SCh. 56 - Explain several detailed ways in which increasing...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning