
Campbell Biology (11th Edition)
11th Edition
ISBN: 9780134093413
Author: Lisa A. Urry, Michael L. Cain, Steven A. Wasserman, Peter V. Minorsky, Jane B. Reece
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 46, Problem 46.4CR
Summary Introduction
To explain: Anabolic steroids lead to reduced sperm counts.
Concept introduction:
Endocrine system coordinates and controls the reproduction in mammals. The hypothalamus releases gonadotropin-releasing hormone that stimulates the anterior pituitary gland to secrete follicle-stimulating hormone (FSH) and luteinizing hormone (LH). Both FSH and LH are gonadotropins, as they stimulate gonads—testes in males and ovaries in females. The secretion levels of hormones are based on the feedback regulation.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 46 Solutions
Campbell Biology (11th Edition)
Ch. 46.1 - Compare and contrast the outcomes of asexual and...Ch. 46.1 - Parthenogenesis is the most common form of asexual...Ch. 46.1 - WHAT IF? If a hermaphrodite self-fertilizes, will...Ch. 46.1 - Prob. 4CCCh. 46.2 - How does internal fertilization facilitate life on...Ch. 46.2 - What mechanisms have evolved in animals with (a)...Ch. 46.2 - MAKE CONNECTIONS What are the shared and distinct...Ch. 46.3 - Why might frequent use of a hot tub make it harder...Ch. 46.3 - Prob. 2CCCh. 46.3 - WHAT IF? If each vas deferens in a male was...
Ch. 46.4 - How are the functions of FSH and LH in females and...Ch. 46.4 - How does an estrous cycle differ from a menstrual...Ch. 46.4 - WHAT IF? If a human female begins taking...Ch. 46.4 - Prob. 4CCCh. 46.5 - Prob. 1CCCh. 46.5 - In what ways are tubal ligation and vasectomy...Ch. 46.5 - Prob. 3CCCh. 46 - Would a pair of haploid offspring produced by...Ch. 46 - Identify which of the following, if any, are...Ch. 46 - How does the difference in size and cellular...Ch. 46 - Prob. 46.4CRCh. 46 - Prob. 46.5CRCh. 46 - Prob. 1TYUCh. 46 - In male mammals, excretory and reproductive...Ch. 46 - Prob. 3TYUCh. 46 - Prob. 4TYUCh. 46 - Prob. 5TYUCh. 46 - Prob. 6TYUCh. 46 - Prob. 7TYUCh. 46 - Prob. 8TYUCh. 46 - DRAW IT In human spermatogenesis, mitosis of a...Ch. 46 - Prob. 10TYUCh. 46 - SCIENTIFIC INQUIRY You discover a new egg-laying...Ch. 46 - WRITE ABOUT A THEME: ENERGY AND MATTER In a short...Ch. 46 - SYNTHESIZE YOUR KNOWLEDGE A female Komodo dragon...
Knowledge Booster
Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax


Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College