
Concept explainers
Introduction:
The pore-forming membrane proteins are referred to as ion channels, which permit the ions to cross the channel pore. Their main functions include establishing a resting membrane potential and shaping action potentials and other signals by allowing the flow of ions across the membrane.

Answer to Problem 1TYK
Correct answer:
The neurons have a significantly larger number of potassium leak channels, which facilitate the leakage of potassium ion across the membrane.
Explanation of Solution
Explanation/Justification for the correct answer:
Option (b) is given as potassium ion (K+). K+ is a micronutrient that is required by almost all cell types and is also necessary for the maintenance of the electrolyte and fluid balance in the body. The sodium–potassium pump creates the potassium gradient across the cell, with the higher concentration of potassium inside the cell. Thus, the K+ ions move from a higher concentration region to a lower concentration region, in turn generating an action potential. Furthermore, this helps in achieving the negative resting potential of the cell. Hence, option (b) is correct.
Explanation for incorrect answers:
Option (a) is given as calcium ions (Ca2+). The leakage of Ca2+ ions does not occur in order to achieve the resting potential as the concentration gradient for Ca2+ ions is not created by the sodium–potassium pump. So, it is a wrong answer.
Option (c) is given as sodium ions (Na+). The number of leak channels for Na+ ions is comparatively less than that for potassium ions. So, it is a wrong answer.
Option (d) is given as chloride ions (Cl+). The chloride ions are present as Cl− and not as Cl+. So, it is a wrong answer.
Hence, options (a), (c), and (d) are incorrect.
Therefore, it can be concluded that the potassium ions leak across the neuron’s membrane and thereby accomplish the resting potential.
Want to see more full solutions like this?
Chapter 43 Solutions
Biological Science, Books a la Carte Plus Mastering Biology with Pearson eText -- Access Card Package (6th Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning




