1 SEM CARDLESS ACC W/RAVEN TEXT
12th Edition
ISBN: 9781265321062
Author: Raven
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Question
Chapter 42, Problem 4S
Summary Introduction
To determine:
The reason why Karen needs to drink more caffeinated beverages in order to get the same effect that she earlier used to get with lesser caffeinated beverages.
Introduction:
Habituation is the process when certain cells of the nervous system lose their ability to respond to a particular stimulus due to overexposing or prolonged usage of that stimulus. Some of the nerve cells are more prone to habituation than others.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 42 Solutions
1 SEM CARDLESS ACC W/RAVEN TEXT
Ch. 42.1 - Differentiate between subdivisions of the...Ch. 42.1 - Prob. 2LOCh. 42.1 - Explain the roles of the different nervous system...Ch. 42.2 - Contrast the relative concentrations of important...Ch. 42.2 - Prob. 2LOCh. 42.2 - Prob. 3LOCh. 42.3 - Prob. 1LOCh. 42.3 - Prob. 2LOCh. 42.3 - Prob. 3LOCh. 42.4 - Prob. 1LO
Ch. 42.4 - Prob. 2LOCh. 42.4 - Prob. 3LOCh. 42.5 - Describe the organization of the peripheral...Ch. 42.5 - Prob. 2LOCh. 42.5 - Prob. 3LOCh. 42.5 - Prob. 4LOCh. 42 - Data analysis Draw the resulting potentials for...Ch. 42 - Prob. 2DACh. 42 - Which of the following best describes the...Ch. 42 - The ____ cannot be controlled by conscious...Ch. 42 - Prob. 3UCh. 42 - Inhibitory neurotransmitters a. hyperpolarize...Ch. 42 - White matter is ______, and gray matter is...Ch. 42 - During an action potential a. the rising phase is...Ch. 42 - Prob. 7UCh. 42 - Imagine that you are doing an experiment on the...Ch. 42 - The Na+/K+ ATPase pump is a. not required for...Ch. 42 - Prob. 3ACh. 42 - The following is a list of the components of a...Ch. 42 - Prob. 5ACh. 42 - As you sit quietly reading this sentence, the part...Ch. 42 - G proteincoupled receptors are involved in the...Ch. 42 - Tetraethylammonium (TEA) is a drug that blocks...Ch. 42 - Describe the status of the Na+ and K+ channels at...Ch. 42 - Describe the steps required to produce an...Ch. 42 - Prob. 4S
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningLifetime Physical Fitness & WellnessHealth & NutritionISBN:9781337677509Author:HOEGERPublisher:Cengage
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Lifetime Physical Fitness & Wellness
Health & Nutrition
ISBN:9781337677509
Author:HOEGER
Publisher:Cengage
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
Alcohol | Health | topic | FuseSchool; Author: FuseSchool - Global Education;https://www.youtube.com/watch?v=y2Rgxm7Vvi8;License: Standard Youtube License