Campbell Biology: Australian And New Zealand Edition + Mastering Biology With Etext
11th Edition
ISBN: 9781488687075
Author: Lisa, A. Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 41.1, Problem 2CC
Summary Introduction
To explain: Why vitamins are required only in a very small amount.
Concept introduction:
Vitamins are organic molecules and essential nutrient for an organism. Amino acids, vitamins, fatty acids, and minerals are essential nutrients for an organism to perform biological functions. Vitamins are required in a small quantity.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 41 Solutions
Campbell Biology: Australian And New Zealand Edition + Mastering Biology With Etext
Ch. 41.1 - An animal requires 20 amino acids to make...Ch. 41.1 - Prob. 2CCCh. 41.1 - WHAT IF? If a zoo animal eating ample food shows...Ch. 41.2 - Prob. 1CCCh. 41.2 - In what sense are nutrients from a recently...Ch. 41.2 - Prob. 3CCCh. 41.3 - Explain why a proton pump inhibitor, such as the...Ch. 41.3 - Thinking about our nutritional needs and feeding...Ch. 41.3 - Prob. 3CCCh. 41.4 - Prob. 1CC
Ch. 41.4 - What features of a mammal's digestive system make...Ch. 41.4 - WHAT IF? "Lactose-intolerant" people have a...Ch. 41.5 - Explain how people can become obese even if their...Ch. 41.5 - WHAT IF? Suppose you were studying two groups of...Ch. 41.5 - Prob. 3CCCh. 41 - Prob. 41.1CRCh. 41 - Propose an artificial diet that would eliminate...Ch. 41 - Prob. 41.3CRCh. 41 - How does human anatomy indicate that our primate...Ch. 41 - Prob. 41.5CRCh. 41 - Fat digestion yields fatty acids and glycerol....Ch. 41 - The mammalian trachea and esophagus both connect...Ch. 41 - Which of the following organs is incorrectly...Ch. 41 - Prob. 4TYUCh. 41 - Prob. 5TYUCh. 41 - After surgical removal of the gallbladder, a...Ch. 41 - If you were to jog 1 km a few hours after lunch,...Ch. 41 - DRAW IT Create a flowchart to summarize the events...Ch. 41 - EVOLUTION CONNECTION Lizards and snakes cannot...Ch. 41 - SCIENTIFIC INQUIRY In human populations of...Ch. 41 - WRITE ABOUT A THEME: ORGANIZATION Hair is largely...Ch. 41 - SYNTHESIZE YOUR KNOWLEDGE Hummingbirds are well...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningUnderstanding Nutrition (MindTap Course List)Health & NutritionISBN:9781337392693Author:Eleanor Noss Whitney, Sharon Rady RolfesPublisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Understanding Nutrition (MindTap Course List)
Health & Nutrition
ISBN:9781337392693
Author:Eleanor Noss Whitney, Sharon Rady Rolfes
Publisher:Cengage Learning