BIOLOGY:ESSENTIALS NSU- CONNECT
3rd Edition
ISBN: 9781265145125
Author: Hoefnagels
Publisher: MCGRAW-HILL HIGHER EDUCATION
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4, Problem 6MCQ
Summary Introduction
Introduction:
Diffusion takes places in gases. They move from high concentration to low concentration. Diffusion can be simple or facilitated. The molecules do not require energy to move across the membrane in simple diffusion, whereas it required energy to move in case of facilitated diffusion.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 4 Solutions
BIOLOGY:ESSENTIALS NSU- CONNECT
Ch. 4.1 - Describe how your body has potential and kinetic...Ch. 4.1 - Prob. 2MCCh. 4.2 - Prob. 1MCCh. 4.2 - Prob. 2MCCh. 4.2 - Prob. 3MCCh. 4.3 - Prob. 1MCCh. 4.3 - Describe the relationship between energy-requiring...Ch. 4.4 - Prob. 1MCCh. 4.4 - Prob. 2MCCh. 4.4 - What is the role of negative feedback in enzyme...
Ch. 4.4 - Prob. 4MCCh. 4.5 - Prob. 1MCCh. 4.5 - What types of substances diffuse freely across a...Ch. 4.5 - What would happen to a plant cell in a hypertonic...Ch. 4.5 - Prob. 4MCCh. 4.5 - Prob. 5MCCh. 4.5 - Prob. 6MCCh. 4 - Prob. 1MCQCh. 4 - How does ATP participate in coupled reactions? a....Ch. 4 - How do proteins contribute to the function of an...Ch. 4 - Prob. 4MCQCh. 4 - Prob. 5MCQCh. 4 - Prob. 6MCQCh. 4 - Prob. 7MCQCh. 4 - Prob. 8MCQCh. 4 - How does ATP relate to membrane transport? a. The...Ch. 4 - Prob. 1WIOCh. 4 - Prob. 2WIOCh. 4 - Prob. 3WIOCh. 4 - Prob. 4WIOCh. 4 - Use what you know about enzymes to propose an...Ch. 4 - Considering that enzymes are essential to all...Ch. 4 - Prob. 7WIOCh. 4 - Prob. 8WIOCh. 4 - Prob. 9WIOCh. 4 - List three ways the content in this chapter...Ch. 4 - Golden knifefish use an electric field to detect...Ch. 4 - Review Burning Question 4.4, which explains how...Ch. 4 - Prob. 1PITCh. 4 - Prob. 2PITCh. 4 - Prob. 3PITCh. 4 - Prob. 4PIT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning


Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
The Cell Membrane; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=AsffT7XIXbA;License: Standard youtube license