HUMAN ANATOMY
6th Edition
ISBN: 9781260986037
Author: SALADIN
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 4, Problem 5TYR
Summary Introduction
Introduction:
Aneuploidy is a chromosomal condition in which abnormal number of chromosomes, i.e., an extra or lesser number of chromosomes are present.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 4 Solutions
HUMAN ANATOMY
Ch. 4.1 - Prob. 1BYGOCh. 4.1 - Prob. 2BYGOCh. 4.1 - Explain the functions of the sperm’s acrosome and...Ch. 4.1 - Describe two ways a fertilized egg prevents the...Ch. 4.2 - List the four primary tissue types of the adult...Ch. 4.2 - Oligohydramnios17 is an abnormally low volume of...Ch. 4.2 - Prob. 5BYGOCh. 4.2 - Prob. 6BYGOCh. 4.2 - Prob. 7BYGOCh. 4.2 - Prob. 8BYGO
Ch. 4.2 - Prob. 9BYGOCh. 4.2 - Prob. 10BYGOCh. 4.2 - Define and describe the neural tube, primitive...Ch. 4.3 - Prob. 1AWYKCh. 4.3 - Prob. 12BYGOCh. 4.3 - Prob. 13BYGOCh. 4.3 - Why is a baby more likely to be born with...Ch. 4 - Prob. 4.1.1AYLOCh. 4 - Prob. 4.1.2AYLOCh. 4 - Prob. 4.1.3AYLOCh. 4 - Prob. 4.1.4AYLOCh. 4 - Prob. 4.1.5AYLOCh. 4 - Prob. 4.1.6AYLOCh. 4 - Prob. 4.1.7AYLOCh. 4 - The duration of pregnancy and how the date of...Ch. 4 - Prob. 4.2.2AYLOCh. 4 - Prob. 4.2.3AYLOCh. 4 - Prob. 4.2.4AYLOCh. 4 - Prob. 4.2.5AYLOCh. 4 - Prob. 4.2.6AYLOCh. 4 - Prob. 4.2.7AYLOCh. 4 - Prob. 4.2.8AYLOCh. 4 - Prob. 4.2.9AYLOCh. 4 - The major changes that occur during the embryonic...Ch. 4 - Prob. 4.2.11AYLOCh. 4 - How the coelom forms, how it divides into the...Ch. 4 - The meaning of organogenesis, and some tissues and...Ch. 4 - Prob. 4.2.14AYLOCh. 4 - Prob. 4.2.15AYLOCh. 4 - Prob. 4.2.16AYLOCh. 4 - Prob. 4.2.17AYLOCh. 4 - Prob. 4.2.18AYLOCh. 4 - Prob. 4.2.19AYLOCh. 4 - The three modes in which the conceptus is...Ch. 4 - The development and mature structure of the...Ch. 4 - The relationship of the placenta to the umbilical...Ch. 4 - Prob. 4.2.23AYLOCh. 4 - The time at which the individual is considered to...Ch. 4 - Prob. 4.2.25AYLOCh. 4 - Prob. 4.3.1AYLOCh. 4 - Prob. 4.3.2AYLOCh. 4 - Prob. 4.3.3AYLOCh. 4 - Prob. 4.3.4AYLOCh. 4 - Prob. 4.3.5AYLOCh. 4 - Prob. 4.3.6AYLOCh. 4 - Prob. 4.3.7AYLOCh. 4 - When a conceptus arrives in the uterus, it is at...Ch. 4 - The entry of a sperm nucleus into an egg must be...Ch. 4 - Prob. 3TYRCh. 4 - Prob. 4TYRCh. 4 - Prob. 5TYRCh. 4 - Prob. 6TYRCh. 4 - Prob. 7TYRCh. 4 - Prob. 8TYRCh. 4 - Prob. 9TYRCh. 4 - For the first 8 weeks of gestation, a conceptus is...Ch. 4 - Viruses and chemicals that cause congenital...Ch. 4 - Prob. 12TYRCh. 4 - Prob. 13TYRCh. 4 - Prob. 14TYRCh. 4 - Prob. 15TYRCh. 4 - The enzymes with which a sperm penetrates an egg...Ch. 4 - Prob. 17TYRCh. 4 - Prob. 18TYRCh. 4 - Prob. 19TYRCh. 4 - Prob. 20TYRCh. 4 - Prob. 1BYMVCh. 4 - Prob. 2BYMVCh. 4 - Prob. 3BYMVCh. 4 - Prob. 4BYMVCh. 4 - Prob. 5BYMVCh. 4 - Prob. 6BYMVCh. 4 - Prob. 7BYMVCh. 4 - Prob. 8BYMVCh. 4 - Prob. 9BYMVCh. 4 - Prob. 10BYMVCh. 4 - Prob. 1WWWTSCh. 4 - Prob. 2WWWTSCh. 4 - Prob. 3WWWTSCh. 4 - Prob. 4WWWTSCh. 4 - Prob. 5WWWTSCh. 4 - Prob. 6WWWTSCh. 4 - Prob. 7WWWTSCh. 4 - Prob. 8WWWTSCh. 4 - Prob. 9WWWTSCh. 4 - Briefly explain why each of the following...Ch. 4 - Only one sperm is needed to fertilize an egg, yet...Ch. 4 - Prob. 2TYCCh. 4 - Prob. 3TYCCh. 4 - Prob. 4TYCCh. 4 - Prob. 5TYC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Understanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:CengageHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
The Human Reproductive System; Author: Professor Dave Explains;https://www.youtube.com/watch?v=TucxiIB76bo;License: Standard YouTube License, CC-BY