Starting Out with Java: From Control Structures through Data Structures (4th Edition) (What's New in Computer Science)
4th Edition
ISBN: 9780134787961
Author: Tony Gaddis, Godfrey Muganda
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Expert Solution & Answer
Chapter 4, Problem 4FTE
Explanation of Solution
The given program is used to display the “count” value by using “for” condition.
Syntax error:
An error which occurs on the source code of a program is referred to as a “syntax error” because the computer programs strictly follow the syntax rules. If the code fails to prove its language syntax format, then the compiler will throw an error.
Error #1:
The initialization and test expressions should be terminated with semicolons, not commas...
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
MPI Lab Directions
Write an MPI program, countprimes which will count the number of prime numbers in the numbers from 1 to n inclusive where n is a long integer. The value for n which should be set in the program using a constant should be 50,000.
Each process will test its share of the cases.
Each process should not print out any primes that it finds, but it should keep a running total. Before the process finishes, it should print out its ID number and its count of primes that it found.
The master process should end with printing a total for the count of the number of primes and the total amount of time taken to find all the primes.
Take a screenshot of the output for running this with 5 processes.
Before submission, make sure you clean up the directories so that no miscellaneous files are kept around in the submission. (Grade would be deducted if useless files are found in the homework directories.) Include the source code, screenshot, and the Makefile in the submission. Your…
mystery_value = 5
#You may modify the lines of code above, but don't move them!#When you Submit your code, we'll change these lines to#assign different values to the variables.
#Write a program that divides mystery_value by mystery_value#and prints the result. If that operation results in an#error, divide mystery_value by (mystery_value + 5) and then#print the result. If that still fails, multiply mystery_value#by 5 and print the result. You may assume one of those three#things will work.##You may not use any conditionals.#
#Add your code here!
Consider the following pseudo
code,
Method func()
{
PRINT “This is recursive
function"
func()
}
Method main(
{
func()
}
What will happen when the
above snippet is executed?
Chapter 4 Solutions
Starting Out with Java: From Control Structures through Data Structures (4th Edition) (What's New in Computer Science)
Ch. 4.1 - What will the following program segments display?...Ch. 4.2 - How many times will Hello World be printed in the...Ch. 4.2 - How many times will I love Java programming! be...Ch. 4.3 - Write an input validation loop that asks the user...Ch. 4.3 - Write an input validation loop that asks the user...Ch. 4.3 - Write an input validation loop that asks the user...Ch. 4.5 - Name the three expressions that appear inside the...Ch. 4.5 - You want to write a for loop that displays I love...Ch. 4.5 - What will the following program segments display?...Ch. 4.5 - Write a for loop that displays your name 10 times.
Ch. 4.5 - Write a for loop that displays all of the odd...Ch. 4.5 - Write a for loop that displays every fifth number,...Ch. 4.6 - Write a for loop that repeats seven times, asking...Ch. 4.6 - In the following program segment, which variable...Ch. 4.6 - Prob. 4.15CPCh. 4.10 - What is the difference between an input file and...Ch. 4.10 - What import statement will you need in a program...Ch. 4.10 - What class do you use to write data to a file?Ch. 4.10 - Write code that does the following: opens a file...Ch. 4.10 - What classes do you use to read data from a file?Ch. 4.10 - Write code that does the following: opens a file...Ch. 4.10 - You are opening an existing file for output. How...Ch. 4.10 - What clause must you write in the header of a...Ch. 4.11 - Assume x is an int variable, and rand references a...Ch. 4.11 - Assume x is an int variable, and rand references a...Ch. 4.11 - Assume x is an int variable, and rand references a...Ch. 4.11 - Assume x is a double variable, and rand references...Ch. 4 - Prob. 1MCCh. 4 - Prob. 2MCCh. 4 - Prob. 3MCCh. 4 - What is each repetition of a loop known as? a....Ch. 4 - This is a variable that controls the number of...Ch. 4 - The while loop is this type of loop. a. pretest b....Ch. 4 - The do-while loop is this type of loop. a. pretest...Ch. 4 - The for loop is this type of loop. a. pretest b....Ch. 4 - This type of loop has no way of ending and repeats...Ch. 4 - This type of loop always executes at least once....Ch. 4 - This expression is executed by the for loop only...Ch. 4 - Prob. 12MCCh. 4 - This is a special value that signals when there...Ch. 4 - To open a file for writing, you use the following...Ch. 4 - To open a file for reading, you use the following...Ch. 4 - Prob. 16MCCh. 4 - This class allows you to use the print and println...Ch. 4 - This class allows you to read a line from a file....Ch. 4 - True or False: The while loop is a pretest loop.Ch. 4 - True or False: The do-while loop is a pretest...Ch. 4 - True or False: The for loop is a posttest loop.Ch. 4 - True or False: It is not necessary to initialize...Ch. 4 - True or False: One limitation of the for loop is...Ch. 4 - True or False: A variable may be defined in the...Ch. 4 - True or False: In a nested loop, the inner loop...Ch. 4 - True or False: To calculate the total number of...Ch. 4 - // This code contains ERRORS! // It adds two...Ch. 4 - Prob. 2FTECh. 4 - // This code contains ERRORS! int choice, num1,...Ch. 4 - Prob. 4FTECh. 4 - Write a while loop that lets the user enter a...Ch. 4 - Write a do-whi1e loop that asks the user to enter...Ch. 4 - Write a for loop that displays the following set...Ch. 4 - Write a loop that asks the user to enter a number....Ch. 4 - Write a for loop that calculates the total of the...Ch. 4 - Write a nested loop that displays 10 rows of #...Ch. 4 - Convert the while loop in the following code to a...Ch. 4 - Convert the do-while loop in the following code to...Ch. 4 - Convert the following while loop to a for loop:...Ch. 4 - Convert the following for loop to a while loop:...Ch. 4 - Write an input validation loop that asks the user...Ch. 4 - Write an input validation loop that asks the user...Ch. 4 - Write nested loops to draw this pattern:Ch. 4 - Write nested loops to draw this pattern: ## # # #...Ch. 4 - Complete the following program so it displays a...Ch. 4 - Complete the following program so it performs the...Ch. 4 - Prob. 17AWCh. 4 - Prob. 18AWCh. 4 - Modify the code you wrote in Question 18 so it...Ch. 4 - Write code that opens a file named NumberList.txt...Ch. 4 - Prob. 1SACh. 4 - Why should you indent the statements in the body...Ch. 4 - Describe the difference between pretest loops and...Ch. 4 - Why are the statements in the body of a loop...Ch. 4 - Describe the difference between the while loop and...Ch. 4 - Which loop should you use in situations where you...Ch. 4 - Which loop should you use in situations where you...Ch. 4 - Which loop should you use when you know the number...Ch. 4 - Why is it critical that accumulator variables are...Ch. 4 - What is an infinite loop? Write the code for an...Ch. 4 - Prob. 11SACh. 4 - What does it mean to let the user control a loop?Ch. 4 - What is the advantage of using a sentinel?Ch. 4 - Prob. 14SACh. 4 - Describe a programming problem requiring the use...Ch. 4 - How does a file buffer increase a programs...Ch. 4 - Why should a program close a file when its...Ch. 4 - What is a files read position? Where is the read...Ch. 4 - When writing data to a file, what is the...Ch. 4 - What does the Scanner classs hasNext method return...Ch. 4 - What is a potential error that can occur when a...Ch. 4 - Prob. 22SACh. 4 - How do you open a file so that new data will be...Ch. 4 - Sum of Numbers Write a program that asks the user...Ch. 4 - Distance Traveled The distance a vehicle travels...Ch. 4 - Distance File Modify the program you wrote for...Ch. 4 - Pennies for Pay Write a program that calculates...Ch. 4 - Prob. 5PCCh. 4 - File Letter Counter Write a program that asks the...Ch. 4 - Hotel Occupancy A hotels occupancy rate is...Ch. 4 - Average Rainfall Write a program that uses nested...Ch. 4 - Population Write a program that will predict the...Ch. 4 - Largest and Smallest Write a program with a loop...Ch. 4 - Celsius to Fahrenheit Table Write a program that...Ch. 4 - Bar Chart Write a program that asks the user to...Ch. 4 - File Head Display Write a program that asks the...Ch. 4 - Line Numbers Write a program that asks the user...Ch. 4 - Uppercase File Converter Write a program that asks...Ch. 4 - Budget Analysis Write a program that asks the user...Ch. 4 - Random Number Guessing Game Write a program that...Ch. 4 - Random Number Guessing Game Enhancement Enhance...Ch. 4 - ESP Game Write a program that tests your ESP...Ch. 4 - Square Display Write a program that asks the user...Ch. 4 - Dice Game Write a program that plays a simple dice...Ch. 4 - Prob. 22PCCh. 4 - Personal Web Page Generator Write a program that...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- When you perform arithmetic operations with operands of different types, such as adding an int and a float, ____________. C# chooses a unifying type for the result you must choose a unifying type for the result you must provide a cast you receive an error messagearrow_forward(Numerical) Write and test a function that returns the position of the largest and smallest values in an array of double-precision numbers.arrow_forwardRacket code only please - primeTest It takes as input any positive integer n and returns true if the absolute value of the polynomial 8n2 − 488n + 7243 is a prime number. For example, the invocation (primeTest 5) should return true. - primeTestSeq This takes two arguments, a low bound and an upper bound. It determines what percentage of the integers between the lower bound and the upperbound are, according to primeTest, a prime number. For example, the invocation (primeTestSeq 1 60) should return 100.arrow_forward
- main() { int a = 1, b = 2, c = 3: printf("%d", a + = (a + = 3, 5, a)) } Output of this code will be ? Subject code - rcs501arrow_forwardfinal int NUM LOOPS = 16; int numTimes for (num Times= 1; numTimes =NUM LOOPS, numTimest+){ System.out println("Value of numTimes is: " + numTumes). numTimes+t, Answer the following four questions with "True" or "False. 1. This loop executes 16 times. 2. This loop could be written as a while loop. 3. Changing the <= operator to < will make no difference in the output. 4. This loop executes 8 times.arrow_forwardWrite MARIE assembly language code to implement the following algorithm:arrow_forward
- ) /₹3soos alspaarrow_forwardC++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forwardRefer to the following code. Which line may be used to complete the code so it would not result to an error? count = 15 while count > 5: print (count) A none of these; the code is complete by itself (B) count == count (C) count = count - 4 (D) count += 1arrow_forward
- #include void main () { int a=5,b=10,c=1; if (a && b>c) { printf("cquestionbank"); } else{ break; } }arrow_forwardComputer Fundamentals & Programming Lec. 8 Assignment Lecture No. 8 兴 1- Write pseudocode that reads two numbers and multiplies them together. 2- Write pseudocode to print all multiples of 5 between 1 and 100 (including both 1 and 100). 3- Write pseudocode that will count all the even numbers up to a user defined stopping point. Hint: For example, say we want to see the first 5 even numbers starting from 0. well, we know that evens numbers are 0, 2, 4, etc. The first 5 even numbers are 0, 2, 4, 6, 8. V The first 8 even numbers are 0, 2, 4, 6, 8,10 ,12, 16arrow_forwardPlease Don't Get Answers From Chegg!! Thank You!arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Microsoft Visual C#Computer ScienceISBN:9781337102100Author:Joyce, Farrell.Publisher:Cengage Learning,C++ for Engineers and ScientistsComputer ScienceISBN:9781133187844Author:Bronson, Gary J.Publisher:Course Technology PtrProgramming Logic & Design ComprehensiveComputer ScienceISBN:9781337669405Author:FARRELLPublisher:Cengage
- C++ Programming: From Problem Analysis to Program...Computer ScienceISBN:9781337102087Author:D. S. MalikPublisher:Cengage Learning
Microsoft Visual C#
Computer Science
ISBN:9781337102100
Author:Joyce, Farrell.
Publisher:Cengage Learning,
C++ for Engineers and Scientists
Computer Science
ISBN:9781133187844
Author:Bronson, Gary J.
Publisher:Course Technology Ptr
Programming Logic & Design Comprehensive
Computer Science
ISBN:9781337669405
Author:FARRELL
Publisher:Cengage
C++ Programming: From Problem Analysis to Program...
Computer Science
ISBN:9781337102087
Author:D. S. Malik
Publisher:Cengage Learning