Biochemistry: Concepts and Connections
1st Edition
ISBN: 9780321839923
Author: Dean R. Appling, Spencer J. Anthony-Cahill, Christopher K. Mathews
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 4, Problem 3P
pppApCpCpupApGpApu-OH
a. Using the straight-chain sugar convention shown on page 79, write the structure of the DNA strand that encoded this short stretch of RNA
b. Using the simplest convention for representing the DNA base sequence (page 79), write the structure of the nontemplate DNA strand.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
pppApCpCpUpApGpApU-OH(a) Using the straight-chain sugar convention, write the structure of the DNA strand that encoded this short stretch of RNA.(b) Using the simplest convention for representing the DNA base sequence, write the structure of the nontemplate DNA strand.
5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’
1. How many cuts do you expect this enzyme to make on the above DNA and how many fragments do you expect to see on your gel? Assume that they are all different sizes.
5’ - A T G G C C C A A C T G A C C - 3’
a. How many nucleotides are listed here
b. How many codons are listed here
c. What are the three structural components of one nucleotide
D.Write the appropriate sequence for the complementary strand above or below the sequence shown. Be sure to include which end of the complementary strand is 5’ and which end is 3
E.If the above sequence is the coding strand, write the RNA strand that will be transcribed
Chapter 4 Solutions
Biochemistry: Concepts and Connections
Ch. 4 - Prob. 1PCh. 4 - What is the difference between a nucleoside...Ch. 4 - pppApCpCpupApGpApu-OH a. Using the straight-chain...Ch. 4 - Shown is a representation of a molecule being...Ch. 4 - Base analysis of DNA from maize (com) shows it to...Ch. 4 - Using the pKa data in Table 4.1 and the...Ch. 4 - For some DNAs, it is possible to separate the two...Ch. 4 - Refer to Figure 4.15, which presents the...Ch. 4 - Suppose that you centrifuged a transfer RNA...Ch. 4 - Predict the structure of a cruciform that could be...
Ch. 4 - DNA from a newly discovered virus was purified,...Ch. 4 - Would you expect Neurospora crassa DNA to have a...Ch. 4 - A circular double-stranded DNA molecule contains...Ch. 4 - The gel electrophoresis pattern in Figure 4.23 was...Ch. 4 - 15. DNA polymerase requires both a template, to be...Ch. 4 - Prob. 16P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- I need help because i don't get it. Can you help me to explain to me, please?arrow_forwardIn Figure 1-8b, can you tell if the number of hydrogenbonds between adenine and thymine is the same as thatbetween cytosine and guanine? Do you think that aDNA molecule with a high content of A + T would bemore stable than one with high content of G + C?arrow_forward34) What amino acid sequence is coded for by the following DNA coding strand? (Recall: the DNA template strand runs 5' to 3' and the mRNA strand runs antiparallel to the DNA template strand. Recall that DNA is translated with a start codon.) 5'-TTATGCGACCAGACCAGTTT-3' Coding strandarrow_forward
- Name a.) ( pair. Indicate hydrogen bonds with dashed lines, number the atoms in the bases according to IUPAC convention, and circle the pyrimidine. Additionally, indicate where the sugar is attached to the base, the major groove, and the minor groove. 8.) Looking at the bases from above, draw a Watson-Crick C-G base b.) ( triple helix (shown below). In this triple helix, a third strand binds in the major groove via base pairs with the existing Watson-Crick bases. This additional base pair is called a Hoogsteen base pair and is indicated by an asterisk followed by the third base. On your drawing add a cytosine in the appropriate location to indicate a CG*C base pair. , it is possible for nucleic acids to form a structure known as a c.) ( between turns, glycosidic bond conformation and sugar conformation differs between A-form DNA and Z-form DNA, Which one is PNA? Indicate (possibly using a table) how the strand width, distancearrow_forwardWhat is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATTarrow_forwardWhat is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGATarrow_forward
- 5'-[seq]-3' The diagram shows the results of gel electrophoresis for Sanger sequencing. The wells are represented by open boxes and the DNA bands are represented by black boxes. The wells are labeled to show which dideoxy reaction was loaded into each. Write the sequence of the original template strand used for this sequencing reaction, with the 5’ end on the left and the 3’ end on the right.arrow_forwardProvide the sequences of the template and coding strands of a DNA double helix that was used to produce this RNA: 5'-AUUACGGUCUAU. Be sure to label the 5' and 3' ends.arrow_forwardPlease help me with the orange question. My answer is leading strand will encounter lagging strand. I dont know if it’s correct. Thank youarrow_forward
- 7 a-d. i. ii. Draw the following base pair arrangements in B-DNA if you were looking down the barrel of the helix. Draw the Hydrogen bonds between the base pairs and label the atoms that participate in these bonds as hydrogen bond donors with a D and hydrogen bond acceptors with an A. Draw a thicker line leaving the atoms that participate in the glycosidic bonds. iii. iv. Label the major and minor groove on the common pairings, shown in "a" and "c". a. Adenine-Thymine Base Pair b. Adenine (rare form)- Cytosine c. Guanine-Cytosine Base Pair d. Guanine (rare form) - Thymine 7e. On your picture in question "a", highlight or circle the proton that shifts when Adenine tautomerizes to its rare imino form. Draw an arrow pointing to the atom it moves to. 7f. On your picture in question "c", highlight or circle the proton that shifts when Guanine tautomerizes to its rare enol form. Draw an arrow pointing to the atom it moves to.arrow_forwardGiven the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'arrow_forward5' G-A-T-A-с-А-А-с-А-т-G-6-A-с-А-т-G-А-с-т3 What would be the first 3 bases in the 5' end of the complementary strand? Indicate the base sequence and the direction of synthesis of a 3-nucleotide RNA primer. Indicate the base sequence and the direction of synthesis of a 5-nucleotide Okazaki fragment (include a 3 nucleotide RNA primer, a total of 8 bases in the sequence). Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair and G-C base pair?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license