Microbiology: A Systems Approach
4th Edition
ISBN: 9780073402437
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4, Problem 1CM
Summary Introduction
To create:
A concept map illustrating the relationships among key terms such as genus, species, serotype, domain, Borrelia burgdorferi and spirochete.
Concept introduction:
The most common type of the prokaryotes is bacteria. They are found in every existing environment on the earth and although they are small in size, their biomass exceeds of animals and plants combined. The cell wall of bacteria is made up of peptidoglycan layer, they lack membrane-bound organelles and exhibit an asexual mode of reproduction.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Please help
Please draw a Volvox and label it with the following terms: Volvox, Clade Viridiplantae, Daughter colony.
Please be sure to include all the terms provided in the illustration. Thank you.
Strepto-and Staphylo- are prefixes that describe:
Ocell arrangement
virulence
spore location
morphology
Chapter 4 Solutions
Microbiology: A Systems Approach
Ch. 4.1 - List the structures all bacteria possess.Ch. 4.1 - Identify at least four structures that some, but...Ch. 4.1 - Prob. 3AYPCh. 4.1 - Prob. 4AYPCh. 4.1 - Provide at least four terms to describe bacterial...Ch. 4.2 - Describe the structure and function of five...Ch. 4.2 - Prob. 7AYPCh. 4.3 - Prob. 2CFCh. 4.3 - Prob. 8AYPCh. 4.3 - Prob. 9AYP
Ch. 4.3 - Prob. 10AYPCh. 4.4 - Prob. 11AYPCh. 4.4 - Prob. 12AYPCh. 4.5 - List some differences between archaea and...Ch. 4.6 - Differentiate between Bergeys Manual of Systematic...Ch. 4.6 - Prob. 15AYPCh. 4.6 - Define a species in terms of bacteria.Ch. 4.6 - Prob. 2CFCh. 4 - Prob. 1CFCh. 4 - Which of the following is not found in all...Ch. 4 - Pili are tubular shafts in ____ bacteria that...Ch. 4 - Prob. 3MCQCh. 4 - Which of the following is a primary bacterial cell...Ch. 4 - Which of the following is present in both...Ch. 4 - Darkly stained granules are concentrated crystals...Ch. 4 - Bacterial endospores usually function in a....Ch. 4 - A bacterial arrangement in packets of eight cells...Ch. 4 - Prob. 9MCQCh. 4 - Prob. 10MCQCh. 4 - Prob. 11TFCh. 4 - A research microbiologist looking at evolutionary...Ch. 4 - Nanobes may or may not actually be bacteria.Ch. 4 - Both bacteria and archaea used to be known as...Ch. 4 - Prob. 15TFCh. 4 - Define the term ubiquitous and explain whether...Ch. 4 - Prob. 2CTQCh. 4 - Quorum sensing is a process used by many bacteria...Ch. 4 - Prob. 4CTQCh. 4 - Prob. 5CTQCh. 4 - Based upon your knowledge of cell wall structure,...Ch. 4 - Provide evidence in support of or refuting the...Ch. 4 - a.Describe the characteristics of an...Ch. 4 - Prob. 9CTQCh. 4 - Prob. 10CTQCh. 4 - Prob. 1CCCh. 4 - Prob. 2CCCh. 4 - Prob. 1VCCh. 4 - From chapter 1, figure 1.14. Study this figure....Ch. 4 - Prob. 1CM
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTarrow_forward- Chrysophyta group placed under phylum chromista according to the 6 system classification. Given the above information, please explain and state the reason for placing this organism into each one of the taxon. Thank you!!arrow_forwardCreate a phylogenetic tree for the following organisms: Glomus Spirogyra Entamoeba Radiolarian Shimeji mushroom water mold slime mold Aspergillusarrow_forward
- This bacterium is a gram positive rod. It is negative for the catalase reaction but does produce gas from glucose. What is it?arrow_forwardCASE #2 A 25-year-old Peace Corps worker has just returned from service in Ethiopia. She experiences a sudden onset of asthma-like symptoms. She has no previous history of asthma. An O & P (ova and parasites) on her stool was part of the normal discharge physical, considering the area of assignment, before being released from the Peace Corps. The sample was processed according to standard laboratory procedures. Two suspicious structures were noted during the direct saline wet preparation. The first of the two structures is noted in form # 1; it measures 50 x 40 um. The second structure is depicted in form #2 and measures 18 um in diameter. Form 1 Form 2 1. Which of the structures is (are) considered a pathogenic parasite(s)? Do the presenting symptoms relate to the O & P findings? If so, explain. Look at the structure depicted in form #1. What key characteristics allow you to identify the organism? Name the organism and its stage. 2. 3.arrow_forwardAfter you're done the organizer take a look at the site: https://www.bibme.org/apa/film-citation about APA citatarrow_forward
- Please answer asap and type your answer and do not copy from anywhere please ? List the dimorphic fungi by genus and species and describe the growth rate of the mold form and yeast conversions: a. Histoplasma capsulatum b. Sporothrix schenckii c. Coccidioides immitis d. Paracoccidioides brasiliensis e. Blastomyces dermatitidisarrow_forwardHow do I go about drawing a biological drawing of Sarcina lutea? Apparently it has been reclassified as Micrococcus luteus, and I have found an image for me to base my drawing on (image attached), but I don't exactly know which parts to label. Hope I can get some help on this.arrow_forwardGive the correct scientific name of the following: It is is the slides, textbook, and videos I gave you. This is a give away question if you have learned the system. Give a description of each species, including its domain and kingdom. kainops invius bacillus anthracisraphus cucullatusmilnesium tardigradumarchaeopteryx lithographicaarrow_forward
- Please fill-up/ answer the Descriptive Characteristics for Genus Identification of the Cyanobacterium B.in the Table. Morpho-cytological Characteristics Characters 1. Vegetative cell shape (2D) 2. Vegetative cellular arrangement (grouping) 3. Number of cells in large aggregates (colonies) 4. Layers of trichomes in a filament 5. Presence and shape of a heterocyst in the trichome 6. Presence and shape of akinetes in the trichome 7. Presence of baecytes (endospores) in a colony 8. Polarity and tapering of the trichome 9. Shape of end cells in a filament 10. Presence of a gelatinous or colonial sheath 11.Presence of branching 12. Protoplasm color 13. Protoplasm granulation 14. Thylakoid arrangement if observable (ultrastructural)arrow_forwardfungus Aspergillus sydowii Write a short summary (4 paragraphs) about fungus Aspergillus sydowii using all four resources.please add the citations within the text. 1) Presence of Aspergillus sydowii, a pathogen of gorgonian sea fans in the marine sponge Spongia obscura N Ein-Gil, M Ilan, S Carmeli, GW Smith, JR Pawlik… - The ISME …, 2009 2) Purification and Biochemical Characterization of Two Xylanases from Aspergillus sydowii SBS 45 SG Nair, R Sindhu, S Shashidhar - Applied biochemistry and …, 2008 3) Biotechnological potential of a novel tannase-acyl hydrolase from Aspergillus sydowii using waste coir residue: Aqueous two-phase system and chromatographic … KKSA Albuquerque, WWC Albuquerque… - Biocatalysis and …, 2020 4) Aspergillus sydowii: Genome Analysis and Characterization of Two Heterologous Expressed, Non-redundant Xylanases SC Brandt, B Ellinger, T Van Nguyen… - Frontiers in …, 2020arrow_forwardKarelina Bologicel Supply Company Give the DOMAIN for these organismsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Fossil: The Language & History of Paleontology; Author: Alliterative;https://www.youtube.com/watch?v=x9yNwRBlKtU;License: Standard youtube license