
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 3.L1, Problem 9MCQ
Summary Introduction
Introduction:
Magnification is the ability to make objects appear enlarged. It enables the ready observation of tiny life forms that cannot be seen with naked eyes, which is facilitated by microscopes. Magnification in most microscopes results from a complex interaction between visible light waves and the curvature of the lens.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 3 Solutions
Foundations in Microbiology
Ch. 3.1 - Explain what unique characteristics of...Ch. 3.1 - Briefly outline the processes and purposes of the...Ch. 3.1 - Name the notable features of microorganisms that...Ch. 3.1 - In one sentence each, define what is involved in...Ch. 3.2 - Prob. 3ELOCh. 3.2 - Prob. 4ELOCh. 3.2 - Prob. 5ELOCh. 3.2 - Prob. 6ELOCh. 3.2 - Prob. 7ELOCh. 3.2 - Prob. 8ELO
Ch. 3.2 - Prob. 3CYPCh. 3.2 - Prob. 4CYPCh. 3.2 - Prob. 5CYPCh. 3.2 - Prob. 6CYPCh. 3.2 - Prob. 7CYPCh. 3.2 - Prob. 8CYPCh. 3.2 - Prob. 9CYPCh. 3.2 - Compare the way that the image is formed in the...Ch. 3.3 - Prob. 9ELOCh. 3.3 - Define dyes and describe the basic chemistry...Ch. 3.3 - Prob. 11ELOCh. 3.3 - Distinguish between simple, differential, and...Ch. 3.3 - Describe the process of Gram staining and how its...Ch. 3.3 - Prob. 11CYPCh. 3.3 - Explain what happens in positive staining to cause...Ch. 3.3 - Prob. 13CYPCh. 3.3 - For a stain to be considered differential, what...Ch. 3.3 - Prob. 15CYPCh. 3.4 - Prob. 14ELOCh. 3.4 - Prob. 15ELOCh. 3.4 - Explain what an isolated colony is and indicate...Ch. 3.4 - Differentiate between a pure culture, subculture,...Ch. 3.4 - What kinds of data are collected during...Ch. 3.4 - Prob. 19ELOCh. 3.4 - Prob. 16CYPCh. 3.4 - Prob. 17CYPCh. 3.4 - Prob. 18CYPCh. 3.4 - Compare and contrast three common laboratory...Ch. 3.4 - Describe how an isolated colony forms.Ch. 3.4 - Prob. 21CYPCh. 3.5 - Prob. 20ELOCh. 3.5 - Name the three general categories of media, based...Ch. 3.5 - Compare and contrast liquid, solid, and semisolid...Ch. 3.5 - Prob. 23ELOCh. 3.5 - Prob. 24ELOCh. 3.5 - Identify the qualities of enriched, selective, and...Ch. 3.5 - Explain what it means to say that microorganisms...Ch. 3.5 - Describe live media and the circumstances that...Ch. 3.5 - Describe the main purposes of media, and compare...Ch. 3.5 - Differentiate among the ingredients and functions...Ch. 3.5 - Explain the two principal functions of dyes in...Ch. 3.5 - Why are some bacteria difficult to grow in the...Ch. 3.5 - What conditions are necessary to cultivate viruses...Ch. 3.L1 - Prob. 1MCQCh. 3.L1 - Prob. 2MCQCh. 3.L1 - Prob. 3MCQCh. 3.L1 - Prob. 4MCQCh. 3.L1 - Prob. 5MCQCh. 3.L1 - Prob. 6MCQCh. 3.L1 - Resolution is _____________ with a longer...Ch. 3.L1 - Prob. 8MCQCh. 3.L1 - Prob. 9MCQCh. 3.L1 - The specimen for an electron microscope is always...Ch. 3.L1 - Motility is best observed with a a. hanging drop...Ch. 3.L1 - Prob. 12MCQCh. 3.L1 - Prob. 13MCQCh. 3.L1 - Prob. 14MCQCh. 3.L1 - What type of medium is used to maintain and...Ch. 3.L1 - Prob. 16MCQCh. 3.L1 - Multiple Matching. For each type of medium, select...Ch. 3.L1 - Prob. 1CSRCh. 3.L1 - Prob. 2CSRCh. 3.L1 - Prob. 3CSRCh. 3.L1 - Prob. 1WCCh. 3.L1 - Prob. 2WCCh. 3.L1 - Prob. 3WCCh. 3.L1 - Describe the steps of the Gram stain, and explain...Ch. 3.L1 - Describe the steps you would take to isolate,...Ch. 3.L1 - Prob. 6WCCh. 3.L1 - Evaluate the following preparations in terms of...Ch. 3.L2 - A certain medium has the following composition: a....Ch. 3.L2 - a. Name four categories that blood agar fits. b....Ch. 3.L2 - Prob. 3CTCh. 3.L2 - Go back to section 1.2 and observe the six...Ch. 3.L2 - Since the dyes for the Gram stain are not specific...Ch. 3.L2 - Examine figure 3.10a, b (shown here). If you...Ch. 3.L2 - Prob. 2VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
- Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage