
Foundations in Microbiology
10th Edition
ISBN: 9781259705212
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 3.5, Problem 20ELO
Summary Introduction
To identify:
The importance of media for culturing microbes in the laboratory.
Introduction:
Microorganisms are isolated and cultured for various reasons. Culture is the observable growth that appears in or on the medium. Sometimes cultures are colonies of a single microbe or more than one microbe depending on the purposes for which they are cultured.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 3 Solutions
Foundations in Microbiology
Ch. 3.1 - Explain what unique characteristics of...Ch. 3.1 - Briefly outline the processes and purposes of the...Ch. 3.1 - Name the notable features of microorganisms that...Ch. 3.1 - In one sentence each, define what is involved in...Ch. 3.2 - Prob. 3ELOCh. 3.2 - Prob. 4ELOCh. 3.2 - Prob. 5ELOCh. 3.2 - Prob. 6ELOCh. 3.2 - Prob. 7ELOCh. 3.2 - Prob. 8ELO
Ch. 3.2 - Prob. 3CYPCh. 3.2 - Prob. 4CYPCh. 3.2 - Prob. 5CYPCh. 3.2 - Prob. 6CYPCh. 3.2 - Prob. 7CYPCh. 3.2 - Prob. 8CYPCh. 3.2 - Prob. 9CYPCh. 3.2 - Compare the way that the image is formed in the...Ch. 3.3 - Prob. 9ELOCh. 3.3 - Define dyes and describe the basic chemistry...Ch. 3.3 - Prob. 11ELOCh. 3.3 - Distinguish between simple, differential, and...Ch. 3.3 - Describe the process of Gram staining and how its...Ch. 3.3 - Prob. 11CYPCh. 3.3 - Explain what happens in positive staining to cause...Ch. 3.3 - Prob. 13CYPCh. 3.3 - For a stain to be considered differential, what...Ch. 3.3 - Prob. 15CYPCh. 3.4 - Prob. 14ELOCh. 3.4 - Prob. 15ELOCh. 3.4 - Explain what an isolated colony is and indicate...Ch. 3.4 - Differentiate between a pure culture, subculture,...Ch. 3.4 - What kinds of data are collected during...Ch. 3.4 - Prob. 19ELOCh. 3.4 - Prob. 16CYPCh. 3.4 - Prob. 17CYPCh. 3.4 - Prob. 18CYPCh. 3.4 - Compare and contrast three common laboratory...Ch. 3.4 - Describe how an isolated colony forms.Ch. 3.4 - Prob. 21CYPCh. 3.5 - Prob. 20ELOCh. 3.5 - Name the three general categories of media, based...Ch. 3.5 - Compare and contrast liquid, solid, and semisolid...Ch. 3.5 - Prob. 23ELOCh. 3.5 - Prob. 24ELOCh. 3.5 - Identify the qualities of enriched, selective, and...Ch. 3.5 - Explain what it means to say that microorganisms...Ch. 3.5 - Describe live media and the circumstances that...Ch. 3.5 - Describe the main purposes of media, and compare...Ch. 3.5 - Differentiate among the ingredients and functions...Ch. 3.5 - Explain the two principal functions of dyes in...Ch. 3.5 - Why are some bacteria difficult to grow in the...Ch. 3.5 - What conditions are necessary to cultivate viruses...Ch. 3.L1 - Prob. 1MCQCh. 3.L1 - Prob. 2MCQCh. 3.L1 - Prob. 3MCQCh. 3.L1 - Prob. 4MCQCh. 3.L1 - Prob. 5MCQCh. 3.L1 - Prob. 6MCQCh. 3.L1 - Resolution is _____________ with a longer...Ch. 3.L1 - Prob. 8MCQCh. 3.L1 - Prob. 9MCQCh. 3.L1 - The specimen for an electron microscope is always...Ch. 3.L1 - Motility is best observed with a a. hanging drop...Ch. 3.L1 - Prob. 12MCQCh. 3.L1 - Prob. 13MCQCh. 3.L1 - Prob. 14MCQCh. 3.L1 - What type of medium is used to maintain and...Ch. 3.L1 - Prob. 16MCQCh. 3.L1 - Multiple Matching. For each type of medium, select...Ch. 3.L1 - Prob. 1CSRCh. 3.L1 - Prob. 2CSRCh. 3.L1 - Prob. 3CSRCh. 3.L1 - Prob. 1WCCh. 3.L1 - Prob. 2WCCh. 3.L1 - Prob. 3WCCh. 3.L1 - Describe the steps of the Gram stain, and explain...Ch. 3.L1 - Describe the steps you would take to isolate,...Ch. 3.L1 - Prob. 6WCCh. 3.L1 - Evaluate the following preparations in terms of...Ch. 3.L2 - A certain medium has the following composition: a....Ch. 3.L2 - a. Name four categories that blood agar fits. b....Ch. 3.L2 - Prob. 3CTCh. 3.L2 - Go back to section 1.2 and observe the six...Ch. 3.L2 - Since the dyes for the Gram stain are not specific...Ch. 3.L2 - Examine figure 3.10a, b (shown here). If you...Ch. 3.L2 - Prob. 2VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Basic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:CengageComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
- Microbiology for Surgical Technologists (MindTap ...BiologyISBN:9781111306663Author:Margaret Rodriguez, Paul PricePublisher:Cengage Learning
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Microbiology for Surgical Technologists (MindTap ...
Biology
ISBN:9781111306663
Author:Margaret Rodriguez, Paul Price
Publisher:Cengage Learning