
Biology: Life on Earth with Physiology (11th Edition)
11th Edition
ISBN: 9780133923001
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 39.5, Problem 5CYL
Summary Introduction
To differentiate:
The short and long-term memory.
Introduction:
The human brain is an impeccably complex structure. It is responsible for many different functions. It plays an important role in signal transmission, memory is explained as the capacity to recollect all events, experiences, and information that is stored in the central nervous system. Memory is of two types, the short-term memory, and long-term memory.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 39 Solutions
Biology: Life on Earth with Physiology (11th Edition)
Ch. 39.1 - describe the structure of a typical neuron?Ch. 39.1 - Prob. 2CYLCh. 39.2 - Prob. 1TCCh. 39.2 - Prob. 1CYLCh. 39.2 - explain how an action potential in a presynaptic...Ch. 39.2 - Prob. 3CYLCh. 39.2 - Prob. 1CSCCh. 39.3 - Prob. 1TCCh. 39.3 - Prob. 1CYLCh. 39.3 - Prob. 2CYL
Ch. 39.3 - explain how the brain determines which muscles to...Ch. 39.4 - describe the anatomy of diffuse and centralized...Ch. 39.5 - John comes to the emergency room with neither...Ch. 39.5 - Prob. 1CSCCh. 39.5 - Prob. 2ETCh. 39.5 - At least two commercial companies, No Lie MRI and...Ch. 39.5 - Prob. 1HYEWCh. 39.5 - distinguish between the central and peripheral...Ch. 39.5 - Prob. 2CYLCh. 39.5 - label diagrams of the human brain and spinal cord,...Ch. 39.5 - Prob. 4CYLCh. 39.5 - Prob. 5CYLCh. 39.5 - Prob. 2CTCh. 39.5 - Prob. 1CSRCh. 39 - Prob. 1MCCh. 39 - Neurotransmitters are typically released by a a....Ch. 39 - Automatic bodily functions such as breathing and...Ch. 39 - Prob. 4MCCh. 39 - Prob. 5MCCh. 39 - Prob. 1FIBCh. 39 - Prob. 2FIBCh. 39 - Prob. 3FIBCh. 39 - Prob. 4FIBCh. 39 - Prob. 5FIBCh. 39 - Prob. 6FIBCh. 39 - Prob. 1RQCh. 39 - Prob. 2RQCh. 39 - What are the four elements of a neuronal pathway,...Ch. 39 - Prob. 4RQCh. 39 - Prob. 5RQCh. 39 - Prob. 6RQCh. 39 - Explain the differences between short-term memory...Ch. 39 - Prob. 1ACCh. 39 - Prob. 2AC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Anatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Anatomy & Physiology
Biology
ISBN:9781938168130
Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble
Publisher:OpenStax College
Information Storage and the Brain: Learning and Memory; Author: Professor Dave Explains;https://www.youtube.com/watch?v=PQDiUKwXLVI;License: Standard youtube license