Campbell Biology: Australian And New Zealand Edition + Mastering Biology With Etext
11th Edition
ISBN: 9781488687075
Author: Lisa, A. Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 39, Problem 13TYU
Summary Introduction
To discuss: How the grazing of shoot tips by an herbivore affects the health, structure, physiology and biochemistry of a plant and which hormones would cause these effects / changes.
Introduction:
Plant-eating animals and insects are a kind of stress for plants. This mechanical stress due to wounding will produce the gas ethylene. This ethylene is a gaseous hormone responsible for the formation of triple response in plants.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Chapter 39 Solutions
Campbell Biology: Australian And New Zealand Edition + Mastering Biology With Etext
Ch. 39.1 - What are the morphological differences between...Ch. 39.1 - Cycloheximide is a drug that inhibits protein...Ch. 39.1 - Prob. 3CCCh. 39.2 - Prob. 1CCCh. 39.2 - WHAT IF? If a plant has the double mutation err...Ch. 39.2 - MAKE CONNECTIONS What type of feedback process is...Ch. 39.3 - If an enzyme in field-grown soybean leaves is most...Ch. 39.3 - WHAT IF? If a plant flowers in a controlled...Ch. 39.3 - MAKE CONNECTIONS Plants detect the quality of...Ch. 39.4 - Prob. 1CC
Ch. 39.4 - Prob. 2CCCh. 39.4 - Prob. 3CCCh. 39.5 - What are some drawbacks of spraying fields with...Ch. 39.5 - Chewing insects mechanically damage plants and...Ch. 39.5 - Many fungal pathogens get food by causing plant...Ch. 39.5 - WHAT IF? Suppose a scientist finds that a...Ch. 39 - What are two common ways by which signal...Ch. 39 - Is there any truth to the old adage, "One bad...Ch. 39 - Why did plant physiologists propose the existence...Ch. 39 - Plants that have acclimated to drought stress are...Ch. 39 - Prob. 39.5CRCh. 39 - Prob. 1TYUCh. 39 - Prob. 2TYUCh. 39 - Prob. 3TYUCh. 39 - How may a plant respond to severe heat stress? (A)...Ch. 39 - Level 2: Application/Analysis 5. The signaling...Ch. 39 - If a long-day plant has a critical night length of...Ch. 39 - Prob. 7TYUCh. 39 - DRAW IT Indicate the response to each condition by...Ch. 39 - Level 3: Synthesis/Evaluation 9. EVOLUTION...Ch. 39 - SCIENTIFIC INQUIRY A plant biologist observed a...Ch. 39 - SCIENCE. TECHNOLOGY, AND SOCIETY Describe how our...Ch. 39 - Prob. 12TYUCh. 39 - Prob. 13TYU
Knowledge Booster
Similar questions
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning