
Concept explainers
To analyze: The price of energy and its real costs. The study of the factors involved in the hidden environmental costs that are not reflected in the real price of the fossil fuels. Also determine the appropriate costs and prices of oil by the manufacturers and investors of shares in the company.
Introduction: The price of setting up various big industries is very costly and expensive for the manufacture of the goods and products. The machines which are manufactured and established in the companies require a tremendous investment from the businessmen and share holding partners. It depends upon appropriate investment policies with genuineness in the partnership relationships. The exhaust of these industries is a serious environmental threat along with the dumping of the toxic byproducts into the rivers and oceans, which causes a threat to the existing species of plants and animals.

Want to see the full answer?
Check out a sample textbook solution
Chapter 38 Solutions
Campbell Biology: Concepts & Connections (8th Edition)
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning



