EBK CAMPBELL BIOLOGY
10th Edition
ISBN: 9780136539414
Author: Reece
Publisher: VST
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 37, Problem 8TYU
Summary Introduction
Introduction: Humus is a well decomposed organic material in soil. Humus contain many important nutrients such as nitrogen, phosphorous, magnesium, iron etc.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 37 Solutions
EBK CAMPBELL BIOLOGY
Ch. 37.1 - Explain how the phrase "too much of a good thing"...Ch. 37.1 - Some lawn mowers collect clippings. What is a...Ch. 37.1 - WHAT IF? How would adding clay to loamy soil...Ch. 37.1 - MAKE CONNECTIONS Note three ways the properties...Ch. 37.2 - Are some essential elements more important than...Ch. 37.2 - WHAT IF? If an element increases the growth rate...Ch. 37.2 - Prob. 3CCCh. 37.3 - Prob. 1CCCh. 37.3 - How do soil bacteria and mycorrhizae contribute to...Ch. 37.3 - MAKE CONNECTIONS What is a general term that is...
Ch. 37.3 - WHAT IF? A peanut farmer finds that the older...Ch. 37 - How is soil a complex ecosystem?Ch. 37 - Do plants need soil to grow? Explain.Ch. 37 - Prob. 37.3CRCh. 37 - Level 1: Knowledge/Comprehension 1. The inorganic...Ch. 37 - Micronutrients are needed in very small amounts...Ch. 37 - Prob. 3TYUCh. 37 - Prob. 4TYUCh. 37 - Prob. 5TYUCh. 37 - A mineral deficiency is likely to affect older...Ch. 37 - The greatest difference in health between two...Ch. 37 - Prob. 8TYUCh. 37 - Prob. 9TYUCh. 37 - Prob. 10TYUCh. 37 - Prob. 11TYUCh. 37 - SCIENTIFIC INQUIRY Acid precipitation has an...Ch. 37 - SCIENCE, TECHNOLOGY, AND SOCIETY In many...Ch. 37 - Prob. 14TYUCh. 37 - Prob. 15TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Industrial Processes and By-products | 9-1 GCSE Chemistry | OCR, AQA, Edexcel; Author: SnapRevise;https://www.youtube.com/watch?v=CMLKgqEMXwc;License: Standard Youtube License