
Biology: Life on Earth with Physiology Plus Mastering Biology with Pearson eText -- Access Card Package (11th Edition)
11th Edition
ISBN: 9780133910605
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 35, Problem 8RQ
Summary Introduction
To determine:
The reason why certain amino acids are essential for humans but not for plants. Explain.
Introduction:
A nutrient is defined as ‘essential’ when it is needed by the organism but cannot be synthesized by the body. Thus, the nutrients must be ingested in foods and then digested and absorbed within the body. Vitamin C is needed for the growth and repair of tissue in all parts of the human body. It forms an important protein used to make skin, ligaments and blood vessels.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is
equivalent to acetyl-CoA.
NADH
FADH2
OP ATP
SLP ATP
Total ATP
Show your work using dimensional analysis here:
5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source.
NADH
FADH2
OP ATP
Show your work using dimensional analysis here:
SLP ATP
Total ATP
Biology
You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Chapter 35 Solutions
Biology: Life on Earth with Physiology Plus Mastering Biology with Pearson eText -- Access Card Package (11th Edition)
Ch. 35.1 - Prob. 1CSCCh. 35.1 - Prob. 1CYLCh. 35.1 - You have probably seen articles warning of the...Ch. 35.1 - Prob. 1TCCh. 35.1 - explain how food energy is measured and how energy...Ch. 35.1 - Prob. 3CYLCh. 35.2 - Prob. 1CYLCh. 35.2 - compare the various ways that invertebrates digest...Ch. 35.2 - explain how vertebrate digestive systems are...Ch. 35.3 - Stomach acid can be very destructive to the...
Ch. 35.3 - The causes of eating disorders are complex and...Ch. 35.3 - Prob. 1CYLCh. 35.3 - Prob. 1ETCh. 35.3 - Prob. 1TCCh. 35.3 - explain how the small intestine absorbs nutrients,...Ch. 35.3 - Prob. 2TCCh. 35.3 - describe feces and how they are produced and...Ch. 35.3 - Prob. 4CYLCh. 35 - Prob. 1FIBCh. 35 - Which of the following is False? a. Carbohydrates...Ch. 35 - Prob. 1RQCh. 35 - Prob. 2ACCh. 35 - Sponges rely exclusively on __________ digestion....Ch. 35 - Prob. 2MCCh. 35 - Prob. 2RQCh. 35 - Prob. 3ACCh. 35 - Prob. 3FIBCh. 35 - Prob. 3MCCh. 35 - Vertebrates can be grouped into three categories...Ch. 35 - The five major processes carried out by the...Ch. 35 - Prob. 4MCCh. 35 - Prob. 4RQCh. 35 - In humans, a cavity called the __________ is...Ch. 35 - Prob. 5MCCh. 35 - Prob. 5RQCh. 35 - Fats are dispersed by a secretion called...Ch. 35 - Prob. 6RQCh. 35 - Prob. 7FIBCh. 35 - Prob. 8RQCh. 35 - Name four structural or functional adaptations of...Ch. 35 - Prob. 11RQCh. 35 - Prob. 12RQ
Knowledge Booster
Similar questions
- Awnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forward
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning