
Biology: Life on Earth with Physiology Plus Mastering Biology with Pearson eText -- Access Card Package (11th Edition)
11th Edition
ISBN: 9780133910605
Author: Gerald Audesirk, Teresa Audesirk, Bruce E. Byers
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 35, Problem 5RQ
Summary Introduction
To enlist:
The function of the “gastric glands”.
Introduction:
Gastric glands release important secretions called as gastric juice and they help in the digestion of the food. Pepsin, hydrochloric acid, and mucus are the three chief secretions of the gastric glands.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 35 Solutions
Biology: Life on Earth with Physiology Plus Mastering Biology with Pearson eText -- Access Card Package (11th Edition)
Ch. 35.1 - Prob. 1CSCCh. 35.1 - Prob. 1CYLCh. 35.1 - You have probably seen articles warning of the...Ch. 35.1 - Prob. 1TCCh. 35.1 - explain how food energy is measured and how energy...Ch. 35.1 - Prob. 3CYLCh. 35.2 - Prob. 1CYLCh. 35.2 - compare the various ways that invertebrates digest...Ch. 35.2 - explain how vertebrate digestive systems are...Ch. 35.3 - Stomach acid can be very destructive to the...
Ch. 35.3 - The causes of eating disorders are complex and...Ch. 35.3 - Prob. 1CYLCh. 35.3 - Prob. 1ETCh. 35.3 - Prob. 1TCCh. 35.3 - explain how the small intestine absorbs nutrients,...Ch. 35.3 - Prob. 2TCCh. 35.3 - describe feces and how they are produced and...Ch. 35.3 - Prob. 4CYLCh. 35 - Prob. 1FIBCh. 35 - Which of the following is False? a. Carbohydrates...Ch. 35 - Prob. 1RQCh. 35 - Prob. 2ACCh. 35 - Sponges rely exclusively on __________ digestion....Ch. 35 - Prob. 2MCCh. 35 - Prob. 2RQCh. 35 - Prob. 3ACCh. 35 - Prob. 3FIBCh. 35 - Prob. 3MCCh. 35 - Vertebrates can be grouped into three categories...Ch. 35 - The five major processes carried out by the...Ch. 35 - Prob. 4MCCh. 35 - Prob. 4RQCh. 35 - In humans, a cavity called the __________ is...Ch. 35 - Prob. 5MCCh. 35 - Prob. 5RQCh. 35 - Fats are dispersed by a secretion called...Ch. 35 - Prob. 6RQCh. 35 - Prob. 7FIBCh. 35 - Prob. 8RQCh. 35 - Name four structural or functional adaptations of...Ch. 35 - Prob. 11RQCh. 35 - Prob. 12RQ
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:CengageHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning