Concept explainers
To explain: The number of times must each meristem cell divide to produce the 100 cells in the given observation.
Introduction: The plants are mainly multicellular, predominantly photosynthetic eukaryotes of the kingdom Plantae. The meristem is a tissue in the plants that consists of undifferentiated cells, which is capable of cell division.

Explanation of Solution
The meristem is classified by their location in the plant as lateral (in vascular and cork cambia), apical (located at shoot and root tips), and intercalary (at internodes). The root apical meristem is also called root apex. The root apical meristem is a small region at the tip of root in which all cells have the ability of repeated division and from which all the primary root tissues are derived.
Each time a meristem cell divides, one daughter cell contributes to a new tissue and others continue as meristem cell. Therefore, each meristem cell would have to divide 10 times for every 100 root cap cells that need to be replaced.
Want to see more full solutions like this?
Chapter 35 Solutions
1 SEM CARDLESS ACC W/RAVEN TEXT
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781337408332Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning




