EP CONNECT ONLINE ACCESS FOR BIOLOGY
20th Edition
ISBN: 9781260494655
Author: Raven
Publisher: MCG COURSE
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 33.8, Problem 1LO
Summary Introduction
To explain: The musculature of a nematode that allows it to wriggle in a highly characteristic manner.
Introduction: Bilaterians are animals with bilateral symmetry, which means the left and right sides of the embryo are mirror images. The bilateral symmetry allowed these animals to achieve high levels of specialization within parts of their bodies, such as the concentration of sensory structures at the anterior phores is truly bilateral.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
Chapter 33 Solutions
EP CONNECT ONLINE ACCESS FOR BIOLOGY
Ch. 33.1 - Prob. 1LOCh. 33.2 - Prob. 1LOCh. 33.2 - Prob. 2LOCh. 33.3 - Prob. 1LOCh. 33.4 - Prob. 1LOCh. 33.4 - Prob. 2LOCh. 33.4 - Prob. 3LOCh. 33.5 - Prob. 1LOCh. 33.6 - Prob. 1LOCh. 33.6 - Distinguish between the Errantia and Sedentaria.
Ch. 33.6 - Describe adaptations in leeches for feeding on the...Ch. 33.7 - Prob. 1LOCh. 33.7 - Prob. 2LOCh. 33.8 - Prob. 1LOCh. 33.8 - Prob. 2LOCh. 33.9 - Prob. 1LOCh. 33.9 - Prob. 2LOCh. 33.9 - Prob. 3LOCh. 33 - In the flatworm, flame cells are involved in what...Ch. 33 - Prob. 2UCh. 33 - Prob. 3UCh. 33 - Prob. 4UCh. 33 - Prob. 5UCh. 33 - Prob. 6UCh. 33 - Prob. 7UCh. 33 - Prob. 8UCh. 33 - Prob. 9UCh. 33 - Prob. 10UCh. 33 - Examples of decapods are a. centipedes and...Ch. 33 - Prob. 1ACh. 33 - Prob. 2ACh. 33 - Prob. 3ACh. 33 - Scientists studying the Chesapeake Bay have...Ch. 33 - Chitin is present in a number of invertebrates, as...Ch. 33 - Prob. 3SCh. 33 - Prob. 4S
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning